Felis_catus Locus RPL4
snOPY snoRNA Orthological Gene Database
Felis_catus RPL4
Felis_catus
RPL4
GeneScaffold_3138
SNORD18, SNORD18
1406..1477, 2186..2255
4434
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTGC
AATGATGTCGTAATTTGCGTCTTACTCTGTTCTCGGCGACAGTTGCCTGCTGTCAGTAAG
CTGGTTCAGAAGGGTGACGAAAATTCTTACTGAGCAAGACATGATCTTTTTTTTTTAATT
GCCAAAATTTTGAGAAATGAGATTCTTAACTGGGAAAATAGATGTGTCGTGGGGGCCGCA
TGTTCGCACCAACGAAAACTTGGCGCCGTTGGCACCGCAGAGTGAACACAACACAGAAGC
GATACGCCATCTGCTCTGCCCTGGCTGCCTCAGCCTTACCAGCACTGGTCATGTCTAAAG
GTTTGTAGATTTTGTTTCATAGGACTGGTACAAAGTACCCTTCCCCCCCCCCCCAACCAT
TTCAATCATGTTAATGATCTGTTTCAATTCTGTTCATCCCAGAGTGCCTGACTAGATTTC
CCTCTTCTGAATAATAGTTCTGACCACTTAGGTCGATAGTAAGTCAGCAGTGAAGACTGT
GTAACTGGGAAAGTAATAGAAATACAGGGATTTCATATGTTGGCAAACTTTTCCACTCGG
TTCATCACGTTCCTACTCTGTAACTGTCAAAATGATGAGATTCCACTTAATTGGTCCGTG
TTTCTGAAACACATGATATTTGTGGAAATTCTGACTTGGCACATTGTATTCCATTTTGCT
TTTGTGGATTATATGAAATGTTTCTCTATTTTTCAAAAGGTTCGGGGTAAATGGTTTTTG
TTAATTGGCTCTGTCAGGTCATCGTATTGAGGAAGTTCCGGAACTTCCTTTGGTGGTTGA
AGATAAAGTTGAAGGCTACAAGAAGACCAAGGAGGCTGTTTTGCTTCTTAAGAAACTTAA
AGCCTGGAATGATATCAAAAAGGTAGGCTTAATGAACAAATTTCCTGTTTGGTGGTCCTT
AATTTCATCAGATTTTAAATTTCAAAAGATGACTGGAGGATAGATAGTATAACTTGAGGG
GCTATGAGAACGAGGATTCTTAAAATCTTATAAAACTTAGGTTTGAATCTTGCCTGGCAT
TTACGGTTGCGTGTGAATGTTGGGCAATTCATCGTGGCTCCTTTCTTTACAGTGGAGACT
GATTTCTTGAAATCACGTTTGAAGATGAATTACTAAGGTCATATTTTAATGAGAGTAATA
AATGTTCTCGCTTTTTAGGTCTATGCCTCTCAACGAATGAGAGCTGGCAAGGGCAAAATG
AGAAACCGTCGTCGTATCCAGCGCAGGGGACCCTGCATCATCTATAATGAGGACAATGGT
ATCATCAAGGCCTTCAGAAACATCCCCGGTAATTGTACTGCTTACGCATGTTTTGCTTGT
CCATACTATGCAAGTTTACTCAGCTTTTACTATGATGAGATTCCACTGTATGGTCCGTGT
TTCTGAAACACATGATTTGGTGGAACTTCTGATTGTCAGCTGAATGAGTACACCGGTGAA
GGTTGGAACTGCCTGATTAGTAACATAGCTCTCAGGTACCTTACATAGCACGAAAGTAGT
GCAGAAGATTTGTGTTTTTGTGTTGAGATACAGACTCCCTAATTTTCTTTTTCCTTTAAA
AGGAATTACTTTGCTTAATGTAAGCAAACTGAACATTTTGCAACTTGCTCCTGGTGGGCA
CGTGGGACGTTTCTGCATCTGGACTGAAAGTGCTTTCCGCAAGTTGGATGATCTGTATGG
CACTTGGCGTAAGGCTGCCTCCCTCAAGAGTAACTACAAGTGAGTATTGTTGGCCTTCAT
GTATCAAACACAGGTGTTTATGCTGCAGATACTTACATTTGCTATTGGTTTGCATGTTTT
GTGAATAATGAATGTGGTTTTGCCATGTGCCCTCATGTACAGATAAGATATGCCAAAATG
GTGAGATACTGTGAGAAGTTGATAGCGTAGTTGAAATTAACTCAGGAGAGCTTCGATTGT
TAGTGAGAATTGGGAATTGAGCATCTTATTGTCAGCATTTTTTTTTCTCAGCCTTCCCAT
GCATAAGATGCTTAATACAGACCTTAGCAGAATCTTGAAGAGCCCTGAGATCCAGAGAGC
CCTCCGAGCACCACGGTAAACTTGTGATACTTAATCTCATTCCAATCTCTTAACCATTAG
TTATTTGAGAAACATGAATAATGTGAACGAAGTTGTTAATATTGTAATGTCTACTTTTCT
ACAGCAAGAAGATTCATCGCAGAGTCCTCAAGAAGAATCCACTGAAAAACCTGAGAATCA
TGTTGAAGCTGAACCCATATGCAAAGACAATGCGCCGGAACACCATTCTTCGCCAGGCCA
AGAATGTAAGTGATAATTTGGTTTTTGCTGATATGTTAAGTTTTTAGAAAGGTTTGATTC
TTAGGTTTTCTTCTTAATTTGTTGCAGCACAAACTCCGGATGGATAAGGCCGCAGCAGCC
TTAGAAGCCAAATCCGAGGAGAAGGGCGTTCCAGGCAAGAAGCCTGTGGTAGGGAAGAAA
GGAAAGAAGGCTGTTGGTGTTAAGAAGCAGAAAAAACCCTTGGCAGGAAAAAAGCCTGCA
ACGACCAAGAAACCAGTAGCTGAGAAGAAGCCTGCAGAGAAGAAACCCACCACGGAAGAA
AAGAAGCCTGCATAAAGCTTAGATTTGTTTATTCCGTAAAAGTTAAATCATTTTGGACAG
CTAATTATGAATAAAGGCCTAATCAAAGACCGTGAGAAACCTGACTTGTTGGATGTGTTT
GTGAATCTTGGTTAGAATTTTATTTTGTTGCCCATAATTCCTGTCTTTTGCTTCCATTTT
TTTGGGGGGGGGTCTGGTATAAAACTGGACTTTGCATTGTAAATCCATGCAGGTGAATGG
AAACAAGAACGCTGCATAAATCCACGTGTAAAATCCAGTTTGTTAGATAACAAGCAGATG
GCTAAAAGACTGGTCTCAGATATGAAGCTATTAGGATTTAGCAATCCTTCCTCAAAAAAA
AAAACTACACCTTCAAAAATAAGTAAAATTCCATAAAGGTTTGGCTTTTACAGTACCACA
AGAGGGCAGAATATATACATTTAGGGGTACTGCATTAAGAAATTGATGGTTCCTCCAGAG
GTTCCTGTTAGAACCTTCTGCGATAGAGTATAGTTATTGCAAGAGATGCTACCCTCAATA
AATTGACCTACGTTATGAAGGTGTCCAAAGCGTTTTTCAGAACTACTTGATACTTGCAGT
TTTACTAAGGGATGAATACAAGTATAGCACAGAGGAGCACCTGGGTGGCTTAGTTGAAAC
TGACTTTAACAGAGGGGTGCCTGGGTGGCTCAGTTGGTTAAGCGTCTGACTTGCACTCAG
GTTATGGTTTTGCGGTTTGTGGGTTCGCGCCCTACATCGAGCTCTGTGCTGACAGCTCGG
AGCCTGGAGCCTGCTTCGTATTCAGTGTCTCTGTCTCTATCAAAAATAAGTAAAAAAAAA
AAAAAAAAACCCAGGCAGGTTCTGCACTGTCAATGCAGAACCTTGTATGGCGCTCCCAAC
TCCTGAAGCATGAGTTCATGGCCAGAGCCAAAGTCCCATCCTTAAAACCCAGAGCATCTG
GCTTGTTTCAAGCTGTGGTCATGATCCCAAGGTCGTGGAATGAAGCCGTGTTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1139, 1577..1701, 1998..2127, 2402..2558, 2811..2894, 3004..3124, 3207..3434
1001..1139, 1577..1701, 1998..2127, 2402..2558, 2811..2894, 3004..3124, 3207..3431
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved