Felis_catus Locus RPL13
snOPY snoRNA Orthological Gene Database
Felis_catus RPL13
Felis_catus
RPL13
GeneScaffold_4190
snoMBII-202
1463..1540
4009
CACTTGCTCTCTTCTCTCCCGCACTGGCTCCCAGCACGTCACATGGAAGTGGAGCTGTG
TGACATCCGTGACAGCCAGTACATTCACTCACCCTGTACGGGACACCGCACGATGTGCTG
TGGTCTAACACAGACTCTCCTCCCACTTCACAGAAGGGAAAAATTCAAACGATGCCCAAC
GTCTCAAAACTAGTACAAAGGTTCCCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAACGCATGCGAAGTACTTACGCTCCAGTTAGAGCACTCAACAAGTGTCACT
TCTGGGTAAACAAAGAAGCACAAATGTTTCAAAAAGTTGGAAAGGCACAAAGACGGACGT
GGAGGCGAGGCTTTAGGGTTAGGGGCACGTACCGAGTCCCGTGACGTGCAGGAGCAGGAA
AGACTCGGCACCCAAACAGCCGCTGCTCTCCTCTGGCCTGGCCGTTCCTCCTTGAAGGCC
GCGGAGTCCCGCAGGACCCGGCGTCCTCCCAGCACGGCCCGGGACCCAACCCGCGGGAAG
CGGGAGGCGCCACGCCCGCCCAGGCCGCGAGGTCTGCTGGGAGAGCGTGGACGTCACTTC
CGGGATCCCGGACTCTGACTGGCCGGAACGCTTCGGCGCTTTTGATTGGCCGAGCCCAAC
ACCATCCCAGGGTGCTTTGTGGTAGCAGTTCCTTTCCGCTGGCCGTTCTCCTCCGGAGGA
GGTGAGTGTGCTCGATTCAGGCGCCTTTGGCTGCATCGTGGTGGTATCCGCCGCCATCAG
TGTAGGGCCGCGTCCGGCGCGGCCGCAGAGGGGCCTCGGGCCCCTGCCACATACGGGAGA
GGGCCGTGGCCCGGGTTCTGTGGCCGGGCGGGCCGATGCGTACTGCCGGGGCCTGACTCG
CTCCCCTCTCCCGCGGCTCCCCAGGCCCGTATGCAGCAGCCATGGCGCCCATTCTGATTG
GGATGATCCTGACTCCCCACGTCCACAAGAACTGGCAGCCGGTGCGTGGCCACATGGTTC
AACCAGCCGGCGCGGAAGATCCGCAGGTAAGCCACCAATGCCGGGTGGGGCCGCGGGGAG
CCCACGGTCAGGTGCGCTTGAACCCCTTGGCCCGGTGAGCGCGCGGCCGTCGGGAGCGTG
GGCCGGGCCGGGAGCGTGCGCCGGGGCCGGGCCGGGGGCCAGCTGACCGCCGCCCGCCTC
TGTCCGCCCAGACGCAAGGCCCGGCAAGCCAAGGCACGCCGCATCGCCCCGCGCCCCGCG
TCCGGACCCATCCGGCCCATCGTCAGGTGCCCCACGGTGCGGTATCACACCAAAGTGCGA
GCCGGCAGGGGCTTCAGCCTGGAGGAGCTGCGGGTGAGTGCGCCGGGAGGCGCGGGAGGC
TCTGCTTGGCGGCCCCCGGTCCATGATGACATTCTCCGGAATCGCTGCACCTCTTTGATG
AGAGCGCTTTTGAACCCTTTTCCATCTGACGGCCGGGCACCCGGGTGGGGGCGCGGGGAG
CAGAGGCCCCGGGGTGGGGGTCCTGCATCCGTGTCTGTCTGGGGGCAGGTGGCTGGCATC
CACAAGAAGGTGGCGCGGACCATCGGGATCTCCGTGGATCCGAGACGGCGGAACAAATCC
ACGGAGTCCCTGCAGGCCAACGTGCAGCGGCTGAAGGAGTACCGCTCCAAGCTGCTCCTG
TTCCCGCGGAGGCCAGCAGCCCCCAAGAAGGGGGACAGCTCGGTGAGTCGCCCTCCCCGC
CGGGTCAGGGTAATCTCTGCGTCCCCGCAGATAGAGGGACGCGTGTGGGTGGAGAAGGGC
AGAGTTCCTGGCGTTTCCCTAGTTGTGCAGAGCACCGGGAGCCCGGCTTTCCCATCTGGG
TCGCGTTCAAAGCTGTTGGCTGGAGGCCGGGGGGTTAGGGGTTTATCTTGTTTGCTTTGT
AAGTTGGCTCACGTACAAACGCTCCCCCGGCGTCTCCATGTCTCTGCTCGACGGAACGGG
GGTTCGGTGACTTGTGCACCCGTTGGCGGGGTCACCCAGCAAGCAGGGCTGTTGTCCAGG
GTTAGAAGCTTGCAGCCTTTGGGGACTTGAGGTGAGCCCGGGTGACTCTTGTCCTTAACC
AACAGGCCGAGGAACTCAAGCTGGCCACGCAGCTGACAGGACCGGTCATGCCCATACGGA
ATGTAAGTGGGCTTTGGGGGGTGAACCAGTGAGTTTTCGGGGCGGAGATTGGGTTGAAGG
GTGGCAGCCAGGGCCTGTGTCAAGATTTATGGGTTTGTGAAAAAGAAACCTTTTTTAACT
TTGGGAGCAACACCCTTCACTCTTAACAGATGGGCTCCTTGAGGGAGGGCCTTGTCTTCA
TCTTTGGGGACTCATTTGTTAGACCTCCTTCGATTTTTTTTTTTTTTTTTTTTTTTTTCT
TTTTTTTTGTTGGCCCCCTCTTTGCTATTTGAAAGGCCAGGCCACAGGTAATTGCACGTT
TGGTGATCCAGGTCGTGACTGGGCCCTTGACTTTCTCTGCCAGGGAGGTGGGCCAGGGCC
TCCCTCGGTCCACGTTCTCTGTTGTTGACGGTGACACAATATCTGTCTCAGCACATCGTC
CCCCAACGGTTGTTTGCATAGCTCAGGGGGTCGCTTCTGCCTCTCCTGTGTGTTTGGCGG
GGGCATTAAAGTCTGTCTTGGTGTCAACGTAGCCTTTCAGCAGCCGATGGGCAGACAGCG
TGCGCCTCCACGGTTTCTGCTATCCTCATATGCTGGGTTTTGTCTCCGGCCTCACTGCAG
GCAAGGGTTTGACTCCTGTGCTCCGTTCCAGGTCTACAAGAAAGAGAAAGCCAGAGTCAT
TACCGAGGAGGAGAAGAACTTCAAGGCGTTTGCCAGTCTTCGCATGGCCCGTGCCCATGC
CCGGCTGTTTGGCATCCGGGCCAAAAGGGCCAAAGAAGCTGCAGAACAGGATGTGGAAAA
GAAAAAATAAAGCGCCGTTGGCAACTTGAGATATTTGCGGTCTCCGTGTGACAGCGGTCT
CCCGTGAGGGGTGGGGCAAGGACGTGGGGATGTGTGCCCTTGCTGAGGAGACCTGGCAGG
GGGTGGCAGCATCTTTGCAGGGAAGTCCAAAGACCGAACTGCTTTTTTTTAGTTTCAGAG
AGCAAATCGCAAGCAGGCTCTGCGCTGTCAGTGTGGGGCCTGACACAGGCTCAAACTCCT
AAACTTTGGTACTTTTTTTTGCAGAGGTGTTATAACGGTTCATTGGCTTCATTGTTAATG
AGTATTTTCCAGTTACTTGAGTGTCTCGGGTCAGACCCTTCCTGGGCCTGTCTGCACTTC
TCCTGTGCCCAGTAGCAGCCCCTTCACCCACATTTGCAAGGCATCCAAGCTTTGGTGCAG
AAAGTTGGCCTTTGTCCATCCTGAACACACGTTCGGGCTACTGAGCCTGTATGGCGGCCA
AGCGTGCCCTCATGGGCAGGCAGCACTGTCCCCGGACCCTTTGTGACAGCATGATGCTTG
AGTTCCTTTGAAACTGGAGCTTGGTTTCTCTACGGGTGGGTACTGAGGTCCAGCCCTGAG
CTGGTCCCTCGTCCCAGCAGGGCCCACTCTGGGGACTGGCACTCAGCAAGTTTTGCTTCA
GTGCTCCAGCCTTGTGGGTATAGGTGTCCACAAGCCATGAGAGGTGTGTGTTTCTGTGTC
TGGTACTTGTGCTGCCACCTGAGTGTGTTTGGAACCAGATTTCAGATAGGTTTTCATCTA
ACAGATGATTTGGAAGGCACTTTACTCCACACCTGAAGTAAGTTTGTAAGGGGCTGACTT
CCATGCTCCTGCACTTGGAGAACCTGTGCCAGGGAAGGGTCAGCTGACGGGTGGGAATTT
GAGGCCAAGCCATGTCCTGGACCATCCTGTGAAGAGGGGATATCCTGGTGGCACGGTTTC
CACAGCATTTGTGCAGAGAACCCGGTAAGGAGTGGGATTAAGCTACCCGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1058, 1060..1105, 1271..1412, 1608..1781, 2165..2221, 2851..3009
1001..1058, 1060..1105, 1271..1412, 1608..1781, 2165..2221, 2851..3006
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved