Felis_catus Locus RPL37
snOPY snoRNA Orthological Gene Database
Felis_catus RPL37
Felis_catus
RPL37
scaffold_180745
SNORD72
3267..3346
4497
TGCCCAGACTAAACTGCAATTCCAGGAACTTTCTGCATTAGGTGCTGTTTCTTACTACG
GTTCTAGTAAGTTCCTACAAACTTAAGAGGCTTAAAACGAAACAAATTAGTGGTGCCTGA
ATGGCTCTGTCTGTTGAGCAACAAAATACTGATTTCGGTTAAGGTCATGATCCCAGAGTA
GTAGGACCACGCTCCAGGTTGGGCCCTGAGCTGAGCCTGCTGGGGATTCTCTCTCTCCCT
GCCTCTGCCCCTCTCCCCCACCCTCACGTGCTCTCTTAAAAAATGTTTTTAAAATAATAA
AAGTGCTTAAGTACAGACTGCCAGGCCCTACCTAAAGGGGCCAAATCAGATTTCCTCACA
TCAGGGTGCAGGAAACTACATCTACAGGTTCCCTTGACACAATATAATTTTAGATCAAAA
TACTTGCCACTAAATTACTACAGCTAGAAAAAAACATGATTCGCCTTTGTTTTTAGATTC
GGAACCCAGCTCTTCAGAGGCCGGTCCGTGTTCTCCATACCGCTGACGACCTCTAGGGAA
GAACCGGCTCAGCCAAGAGCGTCTAGCCAGAAGCGCTAGTTTCTCCCAGCTGGGGATTCC
AGTCCCATCCCGAACCCAACACCTCACGCCGGTAGCGCAGGGTCAGCACGGGCACCCCTA
GGTTCCCCACTGAAATCTGCGGTGTGGCCACAACTCTGAGAACCCGAGAAGGTGGAAGAG
CAGGAGCAGGCGCACAAAGAACGCAGGTCTGGCGTGAACATTGCTCTCGGCCAAGGCGGG
TCCAGCGAAGTCACGCCCATTCGGACACTAGGAAGCTGTGAGCCCTCCCGCCACCCGGCC
CTGAAACCCTTATTGGCCCCGCCTGGCTCTGGATCCTCCTCTAGACCCACCCACACTGCG
CTACGGGCGTTTGAGAACGGTGCACCGGTCCCGCCGGAAGTACTTTCCTGGGCGGAAGCT
TCTGAGCCACCATATAGCGGAAGTGCCTTCTTTTCCGGCCTCTTTGGTCTCGGTTGCGGA
AACAAGATGGTGAGTTTCTTCCAAGGGTTCTGGAATCGCCTTCCATCCTCATCCTCTGCG
TTGTCCTCCTTGCCATCCTTAGGGGGCCGGCAAGGCTCCTGATAAGGGGAGCGGGTGGGC
AGCAACGGGGCCAGTAGAATGGCTCCTAACTGTAACTGGGGTACTCAGTCTGCATCCGTG
GAGCAGCGCCACTCTCGGTCCCTTGCTCCCTTTGATTTTGGGGGAACTCCTTTCCTCGGA
TGAGACTGGAAAAAGCAGCATGTTTTGGGAGTGTTTGGCTCTGTAAAGCAAAGGAATTCA
TTGAAGGGGAGACCTGGCAGGAGCTCTTAGATTTTGGGGGTCGGAATACGTAGGAAAACC
ACCACCTTATTTCGTCTTGCGACTTGTTTTTTCTTTTAAAAAAAAAACGTAGCTGATTTC
GAAATACTGCAACCCTTGTAGAATGCTTTAGGTAACGTGAAATGCTGGTAGTTAATTTAG
CATTTAAAAAGTTAGAAGCTTCCGCTGCAGTTTCAGCCGTAGATTGTCTTTAAAAATCTT
TTTAAAGAGTTAATTTTCTTATCCTGAAGACATCGGGATTCATATAGAAATTATTAGATC
TCCGAATCGTTCATCCCCTTTGCAGACGAAGGGGACGTCATCGTTTGGAAAGCGTCGCAA
TAAGACGCACACGTTGTGCCGCCGCTGTGGCTCGAAGGCCTACCACCTTCAGAAGTCGAC
CTGTGGCAAATGTGGCTATCCTGCCAAGCGAAAGAGAAAGTGTAAGTTGATTGATGTTTC
AACACAACTGTATTAGCTGTTGGAAGGGATGTTAATAGTCTGTTTGCGTTGTACCTAAGT
GGGCATGGCTTTGGGCAGTACTTGGTACTTAACGTAAAAGTGCATCTGTATGTGGACGAA
GTGGATTTAAAAAACAAGGCACTTTTTAAAGTATATTGACCGACAGTGCGTACAACGTGT
GTAGGAAAAACCAGTTAGAACCTGACCTGAATTTATGTTTTAGATAACTGGAGTGCCAAG
GCTAAAAGAAGAAATACCACTGGGACCGGTCGAATGAGGCACCTAAAAATTGTATACCGC
AGATTCAGGTACAGTTTTTGTGTTTCTATCGTAATTGGTTCTGTGAGCTTAAACAAGAAC
CTCTTTATCTACTGTAAACTAGGGATACTGCCCTGGTTGGTGGGAATGACTCATTGGAAG
GTTTTTTTTTTGTTTGTTTTTTTGCTGCCACTGTAAACTTCAGATCAGTTAATCTGCATT
TTGTTAATCTTTCAGTGAGCAATAGTATAAGCTATAAACGTGTAGAGTGATTTGAGCTCG
ACTCCCTCAAATGTAATAATACCAGGGATAATCTACATCTTTCTCACCAAAATTTGTCAG
GACAGTAGTGGTGAATGAGGCCTGGGGTCAGGCCTTCACTTCTGTGGCTTTGAGCAAATC
TGCTACAGAAAACTGTCATAGTTATTGCATTAGTATAGAATGAAAGATACCTTTCTGTCT
TGTCAAAGCCAGGCTTTAGAGTTAGAATGCAGAATTTCAGCTCCAACCTGGACTTTCAGA
GAAACTGCATTTTAACGGCATCTTTTAAGGTGTCTTAGGTCTCAACTAAGATCATTCTTT
GTTGGGGAATCCCTGGCCTTTGCCCCCTCAATTCCAGATTTTCTAATTTTAAAAGATAAC
AAGGAATTTTGAGGCTTTGTAAACACCACACGCTTACATGTGTTTGTGTTCATGTGCTGA
GATGACCTTTCTTTGCCCTTAAAAGCATTATACAGTAGTGTGGGCTTAGTATTGAGTGGT
CTGCTAGTTTAATGTCAGTTTAAGAGCATGAACTGATCAGAAGTCTTTAAAAGGGGGATA
ACTACAGCTGTTGCAGCATCCAGTTCATCTTAAGGATTTCAACCATTAGTCACACAATAA
ATGTTCTGGTTTTAAAAAATATGTGGTGTGCTAAGGTATTTTTAATTGCCTTAGTGTGTA
TGCATATTAAAAGTTAAAAATGTAAAGCATAGTTAAGCAGTTTAGAAAATATCCGCCATT
AAACCTGCTCCTTTTTTGCCTTGGTTAAAGGATACTGCCCAATAGCCTAGGGACACGTTT
TCACAAATAACCTTAGGGCTCTTAATCTGGAAAGAAGTACTGGCCCAGTGATCAGTACAA
CCAAATAAATTGTTGACCTTTTTTCCAATTGCAGTTAAGTATATGCTTAAAATGGGTGAT
TTGATGCAGAAGTAGTAAATAAAATGCAGCTTATCCATGATGTTGTAAAAATAAATGTCT
GAACATATGAATTTGATACTGATTTCAGCATTCAACTGAGATAAGCTCATTTAAATCTGT
ATTAGTAAAAGTTGAAATGTAAATATTGGAGTTGCTGAAGTAATGGTTTTGTTTTTAACA
TTACGCAGGCATGGATTCCGTGAAGGAACAACGCCTAAACCCAAGAGGGCAGCTGTTGCA
GCATCCAGTTCATCTTAAGGATTTCAACGATTAGTCACACAATAAATGTTCTGGTTTTAA
AAAATATGTGGTGTGCTAAGGTATTTTTAATTGCCTTGTATCAGTGAATTACTGTAGGAT
TGGGGATGGGACAACTTAATATTAGAGTTATTGTTAAGTTACTGTTCTGGGGCACTAGTT
TTGACCTGGGTTGTCTCAGCAGACACACTGGAGATAATGGAAAGAAAGTTGGATTTAGCA
AGCCAAGCCCATGTGACATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1028, 1645..1673, 1678..1780, 2023..2107, 3428..3497
1001..1028, 1645..1673, 1678..1780, 2023..2107, 3428..3494
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved