Felis_catus Locus RPL21
snOPY snoRNA Orthological Gene Database
Felis_catus RPL21
Felis_catus
RPL21
scaffold_206886
SNORA27
2113..2239
4245
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGGTTGGGCGTCGGACTTC
GACTGAGGTCACGATCTCAGGGTTCGGATTCGGACCCCACGTCAGGCTTTGTGCTGACAG
CTGGGAGCCTGCAGCCTGCTCCAGATTCTGCCCCTCCCCCATTTGCACCTGCAGGCTCCC
TCTCTCTCAAAATGTTAAAAAAAGTTGCTGAGTGCTTTGTAGACCTGACCCTGTGTAAGA
GATACAGGGTCACAAAAAATGACCTCTTTAAGAGAAGGGGTTTAATCCGCCACGTAAAAA
TGCAGGGCTGAGTTGTTTTGCTCTCCGACAGTAAATTACTGTCCGTTAGTAATTCCAGTG
CCTTTGGCATTCTCAGATGGGTTCTACAAAAGTGGGGCAGAAGTTCTGTGTTTTATGTTC
TAACAGGGAAAGTACTGGTGTGGGTTCCAAAATCCAGGTCTTTGTAGCTTTAATGTTGAT
AGCACTTGGGCAGTTTGCGTGAAGATCTACATGCCAAAATGATGGGGTTTTATCCTTTAT
GGGAAGTAATTGGTGAGTCAGCTTAGATTTTTTTGTTGTAAAGCAAGCATTTGAAATTTA
CGGGGTTTGATTGGGTTTTTTTTGTTTGTTTAAAAAGACAATTACCAATTTTGCGGTTTT
GTTTGATGTTTTATACTTACTGTTTTCAGTAATTCGCCAAAATGACCAACACAAAGGGAA
AGAGGAGAGGTACTCGCTATATGTTCTCTAGGCCTTTTAGAAAACATGGTAAGTAGATAC
TTCCTTCTTGAGAGCAAACATAGTATATATTTGTATAATGTGTTTTTAATAAATGGTGTT
AGTTAACCAGCATCTACCTAACTTGTTCTCTGTAGTAAGTAAAAAGCATAAATTTCATAT
AGTTGTTTTTTGTCAACAAGATTTTAAAAATACAACTGTCAAAGATAAGAGTATGTTGAA
GGCTAGTAAGCTTACATGTATTTTGTAGTCTGGACTTTTTAATCTTGATACTAACTATAC
TGATTTTTTGGGGGACAGGAGTTGTTCCTTTGGCAACATACATGCGCATCTACAAGAAAG
GTGATATTGTGGACATCAAGGTAAATTCTAAAATTGGGTAAATAACCTACAGAACAACAT
TAGAAGCTAGAAAAGTGTAATACTGAAATTCAGATACTAGTGTATATTGTATTTCACCTG
TTGACTTTTTATTCTCCTAAATAGGGGGACATTTTTGGCCTAAATAAGAGCTCATAAATG
TAGAATGGCTAATTTAACTTCCAGAAACCAGAGTTTTTAAAGTGCTATTCTTGAATCTGA
AAACTTTACTACTTGTTTGTTAACAGGTAGTGGAAAAATCAGGTTTTTTAAGGTGGAAAG
GAATAATACGTTAGTACAAAATTTAACTGTTGATGAAGATGGAGATTGCTGTTTTCTAAA
AAACGGTGAAAGTTACGTTCTTTTGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAAAGGG
GAGATTGCTGGCATAACTTTGACCTCCTTTTAACAGGGAATGGGCACTGTTCAAAAAGGA
ATGCCCCACAAATGTTACCACGGCAAAACTGGAAGAGTCTACAATGTTACCCAGCATGCT
GTTGGCATTGTTGTCAACAAACAAGTTAAGTAAGTAACGCCTGGTGTCTTTCCAGCTGAT
TAGTATTCCCTCATACCCCCGTTTCACTTTGCCAATTGGACTTATGTCTTTATTGGTCAT
TCAAGTGGGGCAAAGGAAATATCCTTTCAAAACTCAAGCAAACTGGGTGTTTGTCTTGTA
TCCTGTCAGAGGAAACAAATTGAACTAGACCTAATGAAAAATGTTCATTAGAACTTGGTG
TTAAGCAACTCTGATGTTCAGAGTGTAAAAGGATGTGTAACACGGTGTGAATCTAGTTAG
CGATTTGGTTTGCGTATTTAGTATTGTGAGGTCTGTCACCTCGTTAAAAGAAAGCTTACA
AATGGGGGGTGTTTGCCTCAACGCCTCTTCCAGTACGATTAATAAATGATTGTAAATTAG
CTGTACCTTGCTCTTTAATCCTATTTGTTGGTAAAAGGTTTGTGGTTGATTTATTTTGAA
TGGATTGTGGTTTTTTTGTTTGTTTTGGGGAGAGAGCACATGGGAGCAGGGGAGGGACTG
AGAGAGAGGGAATCCCAGGCTCCACGCTGTCAGCACAGAGCGCAGTGGGGGGCTTGATCT
CCCAAATCAGGATATTGTGGCCTGAGCTCACATCAAGAGTGGGACACTTAACTGACTGAG
CCACCCAGGTGCCCTTAATGTTTGTTTTTTCTTTTTTTTTTTAATAAATGAAATTGGCAG
AAGTGCTTTTGGACTTTGTTACATTTTTGCTGGAGCATTTATAGGAATTTCTGTTCTCCA
GGGGCAAGATTCTTGCTAAGAGAATTAATGTACGTATCGAGCACATTAAGCACTCAAAGA
GCCGAGACAGCTTCCTGAAGCGTGTGAAGGAAAATGATCAGAAAAAGAAGGAAGCTAAGG
AGAAAGGTACTTGGGTTCAACTGAAGCGCCAGGTGAGTGCTTGGCAGATGGCTTCTTGGT
ATTGATCTTGGGAATTTTAAAACTTGCTCAGTGGTCATTTTCTTTTACATGAAAGTTAAT
GAATTGACCATGTTACTTTTTTTTGGTTCTAGAGTACTTTGAAATTGATGATTGTAGTTT
ACATGATTGTTCCCTTGCCTTTTTCTTTTTTAATAGCCTGCCCCACCCAGAGAAGCACAC
TTTGTGAGAACCAATGGAAAGGAGCCTGAGCTGTTGGAACCCATTCCCTATGAATTCATG
GCGTGATAAATGTAAAAAAAATAAAAGATGTCAAGACTATAAAAATGTTTCTTTTAATTG
AGTAGCAGCATGGTATTATCTTCCCCAAAGAAGTATTTAAAGCAAACTTTATATCCTAAT
TCAGTGGGGGATGGCTTTATTCAAATTTTGTGGGTTTTGAGGCACCTGGATGACTCAGTT
AAGCATCGGACTTTGGGTCAGGTCATGATCTTGCAGTCCATGAGTTTGAGCCCCGCGTCA
GGCTCTGTGCTGACAGCTCAGAGCCTGGATCCTGCTTTGGATTCTGTGTCTCCCTCTCTG
TCCTCCCCTGCTTGTGGTCTCTCTAGAGTCAAAAATAAACGTTAAAATATGATGGGGTTT
TTGTTTGTTTTGTTTTTGCTGAAAGATGTGAGGTGGTTTATTGTACAATATACTCAATTG
ATTAGGAACTGCCAGATAGTACCTGTAACATATTTTATAGTAGTTTGAAAATAGTTCCTC
TAAATCACTAAGAAAAAAGATTTTTTAAAAACAAATGAAAGGTTATCTGTTGAGATTGCA
TTTAAGCACGGAAAGTTGAGTACTTGTAATTGTATCAAGTCTTAAGTAGCTATGTTTTAA
GGATAAAGAACTTCCCTTTAAAGCCTATTACTTAAAAAGATTGTTTAAAGCATTCTGGTT
CCCACTAAATTGTTTTCCCTGTCATTTCCTGTTAAGTGTTTTTCTATATGGTGTTAGGAA
GAATTTGTTTATTGGAAACGCTCTTTGTTGCCCCAGGTCCTTTGCACTTGCCTTTGCCCA
AGACTGCCTGTGCTTTCTAAAGTTGGTGAATTCCTGATTGTCCTTTGTTCACCTTGCATG
TCATAAGTGAACCTTCCCTAATGTATTTTAAGGAGAAAGGAGAGGAATGAAACTGGAATC
AAAGGAGAAAATCTGCTTTGGGATGATAGAATTAAATCCCTTATATCTATTACCACGGCA
GGTGTGTTTGCTTTTTTTTTACAGTGTTTATAATTTTGAAAAACTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1338..1399, 1956..2068, 2821..2971, 3156..3245
1001..1067, 1338..1399, 1956..2068, 2821..2971, 3156..3242
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved