Felis_catus Locus ENSFCAG00000004779
snOPY snoRNA Orthological Gene Database
Felis_catus ENSFCAG00000004779
Felis_catus
ENSFCAG00000004779
scaffold_204876
SNORD61
1159..1227
5215
ATTTCGATAAGGCTGAGCGTGTCCGGGGAAAACGGACGTGGGGGCTCCGTTCGGCCGGG
TGCCTCTCGAGAAAGTTTGGCTGTCGCCTGCGGGGGTGGCGGCGGAGGCCGGGGTGGGAA
CGGGACGAGGGCCGACCGCGCCACCGCGGTACCTGCATTGGGATGGCGCTGGCGCTACGG
ACGGGCACGTGCACTTTTACGCGGGTCCTTGTTCATTGGCGGCCTTGGAGAGGAAGCCCT
TCGGCTTTTCCCAGCCACTGCCGATAGCGAAAGTTACTCCCCTGGCCGGTGTAGGCTTTT
CTGGGTTGAATCCAAGTGTCGCCATTTTGTGTTTTCCACGCGCTTTTTAATGACGGGTTT
TAATTGGATTCTGCTGCAGTCATGGAGTGCTGAGTGATACGATGCGCGCTTCCACCTTCC
GTTATTATGAAACGATGCCGAAACCTTTTTTATTTTTAAACCTTTTCGGTGGGGCAGGGG
CTGGTGGAGAAGGGGAGGTATAACTTGGCTCAAACTTGAGATTTCTGCTTAGGTTTACTA
GGGAATCCTAACGAGGAAAGACAAAGTTCTTGGAAGAGGTCCTCCGACTGGCCTGTGACC
TTGAATGAGGCTACACGCTTAAAAAAAAACCATCAGGGTAATTTGGATGTGATCGTTGAA
TCCTTAAAAGGCAACACATGTAGGATTAAAACTAGAACTGCTTTTTCAAACGTTGAGTAG
TTGTTTAAAATTGCCAAGGTGGTTTAAGAATGGAGGCATAAGTTAACTTGGGCCTTTTAA
CTGGTCTAATGCAAACTGCGCTATCACTAAACTACTTAAATTGGTTTCCTGCTGACGCTT
GGAAGAAGAGAATGCTTTTGGTGCCTTCAGTTTTTAAGGAGTGACGATTTTATAGTATAA
CAAGAAAGATGTGCCAATAAATACATGTGTCCCATAAGCTTGAACTTTTTCTAGGGAGGT
AATACTGTTCTTTTTCAACAGACTCTCACCAGGGGGAAAAAATGGTTGAAGCAGATCGCC
CAGGAAAGCTTTTCATTGGTGGCCTCAATACAGAAACAAATGAAAAAGCCCTTGAAGCCG
TATTTGGCAAATATGGACGAATAGTGGAAGGTGAGTTCTCTGAGGGCTTACGGGGAGCTG
TGAATAATTAAAAATGTAAGCTGTGATGAATTTGATTACGTTGATCGTCTGACGTGATAC
ATTTTGTCCTCTAAGAAGTTCTGAGCTTGCATTTTATAGACTAGCTTTGGTTATTTCATT
TGAACTAGAGTAACGCTTCCCCCCCCCCCCAAAAAAAAACTGTGTTTTTTAGTTCTGTTG
ATGAAAGATCGTGAGACCAACAAATCGAGAGGATTTGCTTTTGTCACCTTTGAAAGCCCA
GCAGATGCTAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTTG
CTATTATTTAGTCCTTAGATGGAAAAGCCATCAAGGTAGAACAAGCCACTAAACCGTCAT
TTGAAAGTGGCAGACGTGGACCACCTCCACCCCCAAGAAGCAGAGGCCCCCCAAGAGGTC
TTAGGGGCGGAAGAGGAGGAAGTGGAGGAACCAGGGGACCTCCCTCACGTGGAGGGCACA
TGGGTAATGACTTGGGTCTGCCTCAGGCTTGGTGTGGAATTTGGGAACTGCAGACCTCAC
ACCAGTGTGTGCGTTGGTTAAGTCCTTGTGTAAAGACTCCATCTGATACTGGGAACACTT
GATGCATATATCGAAGTCCATGAGACTTAAGACACCTAGAAGTCATTATAAGTTTGTGTT
TAAAAAAACAGTGGGTGGGGTAACTAGCTGGCTCAAAGCCCCAGATCTCTGGGGTTGTGA
GTTTGAGCCCCACATTGGGCATAGAGCTAATTTAAATATGAAAATGGGCACCAGAACTAG
GTAGTTTGTGGGGGGGAGAAATTGCAGAAGACTTCACAGAAAAATTTTGATCTAGGCCTT
CATTTTAAGTATATAAAAATGAAACCATTCGTGTTTTTTCTTCGAAGCAATTTAAAGACT
ACCATTTTTTGGTTGGTCTAGATAGACTCCCTTCTGCTTAGTAGTCTTGTAGAAGTGAAA
ACGAAAACAAGACTCCCCAACTGAACAGAAAATGGTCATTCTTGATAGAGCAAAAAAGAA
CTTGTACAGCTTCCTACTGATTATTACGACGATTAACAGGTTTTTCTTTTTTATTTTAAT
GTAGATGATGGTGGTTATTCCATGAATTTTAACATGAGTTCTTCCAGGGGACCACTTCCA
GTAAAAAGAGGACCTCCACCAAGAAGTGGCGGCCCTCCTCCTAAAAGATCAGCCCCTTCA
GGACCAGTTCGCAGTAGCAGTGGAATGGGAGGAAGAGGTAAATGCTGGATTTATAGAACA
ATTCATTCTGCCACCATGACCTGCACGTGGTTGACAAGGGATTTAAAAAAATGATGGTTA
AAAATAAAAATCTTCAATATAAAAGATGCTTATGAAAGTGACTCGTGGACTAGGGGTGAT
GTAGGTACGTGAAGTTAATATGCACTGAAAAGACTTGAGTTGTGAACAGGGGGTTTTAGG
GAAGAAACTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCTGCTTTCATTATCTGGAT
GGAAATTCACATTCACCGAAGCTTCCCACTTTGGATGTATTTCTAAAAATGGTTATTTTG
TCTTAAGCTCCTGTGTCACGTGGAAGAGACAGTTATGGAGGCCCACCTCGAAGGGAACCC
CTGCCCTCTCGTAGAGATGTTTATTTGTCCCCAAGAGATGACGGATATTCTACTAAAGAC
AGGTAACAGACAAGTGTAGTAGTTTGTCTCCATAATTTCGGTTGAAGGGAGAACTTGCCA
AAAGTGTGAACCGAGTTAATTTTTGTTTTTGTAGCTATTCAAGCAGAGATTACCCAAGTT
CTCGTGATACAAGAGATTATGCACCACCCCCGAGAGATTATACTTACCGTGACTATGGTC
ATTCCAGTTCACGTGATGACTACCCATCAAGAGGCTATAGGTAAAGTGATACTGCAGCCT
GCGACAGCTTGTAAATAAAATTGCTCTGAATATTGCTACCCTGTGGCTTACGAGTTTTTC
TCTTCAGTGATAGAGATGGCTATGGTCGTGATCGTGACTATTCAGATCATCCGAGTGGAG
GCTCCTACAGAGATTCATATGAGAGTTATGGTAAGATACTGGTTGAGGGTCTTCGAGTAT
CACCAGCTTGAGTTTTTAGGTTCATGAGCCACTTTATTAGGCTGTGTGGTGCTTGCTTTT
TAAGGGATATTTGCTTGCTTTTAAGGGGTAACTTTATCAGCTGGGCTTTTCCTAGTTTTG
TGAGGGGCTTTTGTTTTTTCTAAGTTTTTCTTTTTTTTTTTGAGGCTGTTTGCTTGCTTT
GGAGGGGATTTTGCTTGCTTAAATTGGCAGCCTTATGTGTTTTCCCCCAACAGTGAAAAT
ACAATTTAAAAATTTTATTAACAAGATCAAATGTTTACCATTGCAATATGAAGGAAAGTC
TACAGTTCAAAATTGCAACTTATCACTGGAAAGTGTCTGAGTGTCTTCTCTAAAATAACA
AGCTGTCTGGAATATCCTCTTGAAATACACACCGTCTTCAGTCTTTGCAAACAAACATTA
AAACCCATCCATTTCCGTATCTCAGCAGATGAGCAAATCCCTGTTAATGGCCAGCAATGG
CAGAGTTTAAAACCTTCCAGTTAAGAAAGTAAACGTTTAATACAAGAATTCTGTAAATTC
AGATTTAAATGTTGTATATATACAATTTATAGTGTTGCCATATTACCTGACCATTGACCC
TGCAGGTAACTCACGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 1312..1391, 1511..1682, 2284..2436, 3067..3181, 3274..3399, 3487..3569, 4205..4215
1001..1109, 1312..1391, 1511..1682, 2284..2436, 3067..3181, 3274..3399, 3487..3569, 4205..4215
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved