Felis_catus Locus RPL39
snOPY snoRNA Orthological Gene Database
Felis_catus RPL39
Felis_catus
RPL39
scaffold_204422
SNORA69
3868..3999
5447
TTATTTTTAATTTTTTTTAATTTATTTTTGAGACAGAGAGACACAGAGCGTGAGCAGGG
GAGGGGCAGAGAGAGAGGGAGACACAGAATCCGAAGCAGGCTCCAGGCTCTGAGCTGTCA
GCACGGAGCCTGACGCGGGGCTCGAACTCACGGACTGTGAGATCATGACCTGAGCTGAAG
TCGGACGCTCAACCGACTGAGCCACCCAGGCGCCCCCAAAAGCTTCTGTTTTTAAATGTG
GAGAAGAAAAACATGGAATCGGGGATCATCAACATCCAAAACGCATGTCATTAATTCCTA
TGCATTTTGCAAAGCGGGCTAAAAGTCCGTCTGGGATTCCTAGTAGCCAAGGAAAAGGTT
ATCTCGAAATTTCTCAGCTTAGACCTTGATTAGCAGCAACCTCTTGCCTAGACCTCCCGG
ACCCACCCAGTGCAGCCCTCGCCACCCTCCCTTGCTTTCTCCAACACCACCATCCCTTCC
CGTCCAGCACGGCCCAGCCAGCTGGCAACCTTGCTAGAGGTCGAGATAAGACCGAGATGC
GCACCGCCAGGCCACCCCGGCGGAGGTTAACCCTCGGCGCTCCGCTTCCTAAACCCAGGA
CCGAAGTCTCTTGCACTCGGACGTGACGTATCCCCCACCCGCCCTTGGAGTTAGCCCCGC
CCACTCTGCTCTCTCTGCCCTCGGAAGGGTTACCACTTCGGCTTTTACCGCGGCCTGTGC
GCCTCACCCACGAAGCAGGGTGCCCTGCTCCCGAGGGCCCCACTTACGGAAGTGGCGTAA
AACGGATTCCATTTCGCACGGACAAGCGCGATTTGCCGAGTTCCCACGAGAGCGCGCACG
CGCACGCGTGCGGGGCTGAGGCAGAAAGGGCGGCCAGAGACGGCCAATGGCAGCAGCTTC
CAAGCTCCGCCTCCGGCAACGTCTTCTAAATACGTCCTTCCGCCCGCTTCCTTCTTTTCC
TCCTTCGCCATTTTTGCGTGCGCCGTTGGTCGTTTCTCGCCATGGTAAGTTTATCCGTAA
CCATCGGCCCCGGGGTGCTTTCGCGAGACTTGAGGCTTCCGCGATTTCGCAGGCACCTCA
CGCTGTATCGAGGTGCTGGGGCCTTTTAAAGGCTTTTTCTAGAGAAGGCCGAGTTTGGCC
ACGGCTCCAGCTACAGGCCTGGCGGGAAACTAGCAAGTGATGGGGAACCTAAGGGGGGGG
GGGGGGAGATGGCGCTTTGTGCTCCAGGCCGCTGCCCAGGCTAGTAGGGGTTCCCCCTGC
CCTTCGCCTTTCTGGAGCGAACTGTGATTCTGGGACAGGGAGAGAAGTGGGGGGATCCAC
TCCAGAAACCGTGGCCCGACCTTGGGGCACATGGGACGTGCCAGGCATCGAGAAGGGAAT
GTGGTCACCTGGCTTACGGAAACTTTTTTAAGTTGGCTGCCGCCTGCATAGCAAACTAGG
CGCTTACAGGACTTTTAATTCTTTGTTCGAGGATTTGAGTATCTCCCCCGTGGAAGCACC
TGGAAGAAGGGGTGCTCTAGTGTGAATCTATATGCCATTAGGGCGTTCAACCTAAAATGC
TAACTGAGGACAATTACGGTCGTGGATTTTAACCTGTGATAGGTTTCTTAGAACATAAAA
TTGCCTTCTGCTTCTAGGTGTGGAGAGAGAGGATCGGTAACTGGTTGTTTTAGTTGACAG
AAAATTTACAACTGCCACCGTGAGCTGGGAGAGAGGAGTGTAGCCCTTGCCTTCTTTGTG
ATGGCCCCTGTTATTATGCAAGGGTGTGCTGGACCACGTTGGCCGGACTCGAGACTACCA
CTCCTTCCATTTCCAGATTGTTCTGCATTCTGAGGGCGGGGGGTGGGGGGGGGGGTGTTG
GGGTTGGACTTAGATGACCCAAGTACTTAAAGCCAAAAACCCAATGAGAAATTGGGAAAG
TCATCCTTGAAAATTATGTGTTAAGTACGGTTAGAATTAATACCAAAATGGTCAGTGGGT
TAGAATAGATTTATTGACGGTCAAGGACTTTGTGTATATCTTAATTACTCTTGGGATGAC
CCTTGAAATTAGGTACCTGTTGTACATAGTGCACTGAGACTAGTTGGCTTGCAAGTGACA
GATTGTTCTGGGTGACCAAAAGCTTGTGTCCTTGGGGCCCCTGGATAACTCAGTGGGTTG
GGCGGCCAGCTACAGCTCAGGTCATGATCTCGTGGTCTGTGAGTTCGAGCCCTATGTCTG
AGAGCTGGGAGCCTGGAGCCTGCTTCCGATTCTGTGTCTCCCTCTCTCTCTGCCCCTTCC
CTGCTTGTTCTCTGTCTCTCTCTAAAAAATAATAATAAACAATAAAAAATTTAAAAAAAG
CTTGTGTTCTTTTGTGAAAACCAAGTTCCTCAGCCATCCCCAGTGGTCCTCTGGGTCCTG
GGTGACAGCAGGGAAGAGTGGAAGGCACTCTAGCCTTGGAGCATAGATGACCTGAGCTTG
AATCCCAGCTCTGCACATTAATACTCTGATTTGGGGTAGGTTACTTACTTTTCTGACTCT
TGGTGATTTTTATTTGAACAGTGGGAATTCTACATCTGCCTCTAGAAATTGTAAGAAGCA
GCACAAAGGGCGTGATGGATGGGTGTAGCATTTAGAAGGTTGTTTTTGGTATAGATAAAG
CATTCAAATGTTTGTGGATTGAGGGAGTTCCTGACTTTGAATCTTTTGAGCAAGCTCTGG
TGTTGCTGTCTAAATTGATTACCTTTTTGGGGCACCTGGGTGGCTCAGTCGGTTAAGTGT
CTGACTTGACTTTGGCTCAGGTCATGATCTCACCGTTCGTGAGTGTGAGCCCCGCATCAG
GCTCTGTGCTGACAGCTCGGGACCTGGAGCCTGCTTCAGATTCTGTGTCTCTCTTTCTCT
CTCCCCCTGCCATGCTCATGCTCTCCCTCTCTCAAAAATAAATAAAATATTTTGAAAAAA
TTTTAATTGGTTACCTTTTCTTCCCAGTCTTCTCACAAGACTTTCAGGATCAAGCGATTC
CTGGCCAAGAAACAAAAGCAGAATCGTCCCATTCCCCAGTGGATTCGGATGAAAACTGGT
AATAAAATCAGGTAAGGACCCCCCCCACACACACACACACCCCGCCCTATAATCACCTGC
GTCTTTTGTGGGGTTGTTGTTTTGTTTTAATGTGCTTCTTCTGTGTTTCTGGACAGAAAC
CCAGCCCACCTCTGGGATTAAGGGCAGACACTCCAATATTTGTTAATTTCCTGTTGTCTT
TAGTCTGAGCCAGAACGTAAAGTGGAAGGCTGTCTTGTTGCTCGCCTAGTCCATCTTGGA
GGTGTTTATCTTTTCTAAAAGATTGGAAGATTGGCCTCTACTGCAGAAGTAGTTGAATTG
ATGGTTTTGGAAAAAAGATGGAATTGCTAGAATTGCGACAGAAGGCCTCTGGGGTCATCT
AGGCTAACAGGCAAAGCAGGCTCCGTGTCCTCAGTGCAGAGAGAGAGGGAGAGAGGGAAT
CCCAAGCAGGTTCGACACTGTCAGTGTGGAGCCCGGTGCGGGGCTTGAACTCAGGAACCG
GGAGGTCATGACCTGAGCCAAAATCAAGAGTCACTTAACCAATTGAGCCTCTTGGCGAAG
TGGTTACTTGGGCAGGTCAGCCCTTCTACAAGCTTGCTGCAGTTCCCTTGAGAACATTGG
GCATCCATAGTAAAGCCCTTTTTTAATGGATTGACATGAACATCGGTTTCTCTGTCCTAT
CCCCACCTGGTGGTGGGGCCTGCTGTTATGGGTTATTGTGAGGAGTGAAAGAAATGTATA
TTTCAGAGTATACACTTGGCCCAGAGAACTGGCACAGTTGAAGGATTTTTCTCGTCCCTC
AGCTGCCTTGCAGCTTTCAAAGTGTGTTAAAGCAGGTTGCAATTACAGTGCTTCGTTTTG
TGGAAGTACTGACATTATCCTGCTGAAAGAAAAACAGTGTTGATCATTTTTGATTTTGCC
TCTCTGAGGGTAAAATCAGGACAGATTGACATGGACAATTCTGAGGAGCTTTCACTCTGC
AAGTCACTTGCTTTGATACTGAAATGATTGGGGGTGTTAATCTATTGGAAAGATTCTGCA
GATGCTGTTTTGATGTTTTGAAAGACGGGAGGTTCGAAAATAAAGATGTCTGGGTCTCCC
CGGGGATGTTGAATCACAAGTAGGTGTGCGTACTCTTGGGAGGGGAAAGAACTTCCCCAC
TAGTCCAGTCTCAAGAACCAGTGTGTTTTCTTGGCCTGGAATCCTTTGGAGAGGCAAACA
TTTGATGTGACTAGTTCTTAAACACATCTAGCAAGTCACTTTTTACTCTCCAAAGAGCTC
CAAACGTGTTACGGGAAGGAAAACTGGGAGCCTGTTGAAGTCAGACTGCCTTTGTAACCC
GCAGTTTCCTTCTGTGCAGATACAACTCCAAGAGGCGGCATTGGAGAAGAACGAAGCTGG
GTCTGTAAGGGATCGAACATGAGATGGCACACGTTTATGCCGCCTGAAAGTCATACGTTT
CTATCCCATCACCTCCCTGCTGCCTGACCAGTAGATGTGTTTTATCAGGAAATTGACTTT
TCTCTGTTATGATGCTTCTTCTCCTGTAGGTTGGTTCAGTAATAAATCTGTGAGACCTTT
TGGTTGAACTGCTGTTGTGTTCTGATTTGTGAAGGACTGACTTCCTCCTCCTGTCAGATC
TCCCATAGCGCTGTCCGGTAGAACTTTCTGTAGTGATAGAAATGTCCTTTGACATTGGAA
GGACGTGTGGCTAGTTTGAGTGAAGAGCTGATTTTTTTTTTTCAATGTGTAAATTATTTT
TGAGAGGGGGAGGGTGACACGGAATGTGAAGCAGGCTCCAGGCTCCGAGCTGTCAGCACA
GAGCCCGATGCGGGGCTCGAACCCACAGATCGCAAGACGGTGACCCGGGCTGAAGTCAGA
CGCTTCACCAACTGAGCTACCCAGGCGCCCCAGGAACTGGTTTTTAAATTTTTATTTAAT
TGTAATTAAAAAACTCCATGTGGCTAATGGCTCTTAACGCCTTATGGGAAGTGAATATTT
GAGGTAGCACATTCTTTTTTTTTAAGTAGGTTTCATGCCTGGCACGGAGCCCAACACAGG
GCCCAAACTCGGGACTCTCAGATCAAGAATGGAACTTAAACTGACTGAGCCACTCAGGTG
CCCAAGCACATTCTTAAATAGCATCTTTGTATACTATTCTCTAATGCCAGTCTTCAATAC
AAGTAGGAATCATCTGAACCAGGGGTTATCAGACTGGTCTGCCTGGTTTTGTTTGGCCTG
TGAACTAAATTTCTGTATTTTTAAATTGTTGAACGAAATCAAAAGACTCTTGACACACTG
AAATTCAGATTTACTGGGCCTTTATGTGCCAGGCACTTTTTTTTTTTTTAATGTTTTATT
TATTTTTGAGACCGCATGAACGAGGGAGGGGCAGAGAGAGAGGGAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2967..3070, 4399..4447
1001..1003, 2967..3070, 4399..4444
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved