Felis_catus Locus RPL7A
snOPY snoRNA Orthological Gene Database
Felis_catus RPL7A
Felis_catus
RPL7A
scaffold_201764
SNORD24, SNORD36, SNORD36, SNORD36
1356..1430, 2338..2412, 2728..2799, 3123..3189
4644
GCGCCAGGAGCCTTGCGCCTGCGCGCCGCCGACCGACGGAACTCGCGGCCTCGGAGTCG
CTTAGTGGGGAGGGTCACCCCCGAGTAAAGACGGCGACCCCGCTCCGCCGCCCCCACCTG
GTCCGCAGAGCCCGGCGCGACGGGCACTCGGTCGGGGTGGAGACGAGCGTGCGTCCCTCC
CAGTAAGACCCGGCTCCCTGCCGCCGTCGCCGCTTCGCTCCCGTACAGCTGCGACTCGCC
GCGGTAGGCGCGGTAGGCACCGCCCCTGGGCGGAAGCGGGCGAGATAGGTCCTGTGGCTT
TAAGTCCGAAATCCCGCTCAGGCGTCAATTCTCGCGATCTCCGAGGTCGCCTACATATTA
CCCACAATTCTCTTTTTCTTTCTCTCTCCTCCAGCCTTCCAAGATGGTGAGTGATCCGGT
GGTTCTCGGTGTCGAGCTGGGTCCGGCTTCTATCCACTGCCATCCTCTTCGGGGCGTGGC
CGTGCGGGGGTCCCTCCACCGCGTAGCGCTAGGGGAGCCCCGCGGGGCCTGGCGGGGTGG
CACTGGGCCGGGTAGAATCCCGGCGGCTGGGTCGGGGAGTGGAGAGAGGAGGGCCCCGGC
GCGGAGCGCGGCGCCGCAATGCGGGGCTCGGAGCGACGGGGCCGAGCTCCTGGGGGCTCC
CCCGGCGGCCTTGGGCGAGAGGTTCCGAGTCCACCGCTGCTGTTTGCGGAGGCTGCCGTG
TGCCGGGCGCCTAGAGACGGGGCGCGTAGTTCTGGGACGCGGCGGGCGCGGCAGCCCGGG
TGGTGCAAGTGATGTGAAGAGTGTTTGCCGTCTGAGTGATGGTGGGGACGCTCCTAACCA
CCAAGATCGCTGATGCATACGGGCCCTCGCCGCGCTCGCCTCTGGGCTGCCTTGGCCGGG
GCCTGGGGGGGTCAGGCTCTGCTCGTAGGCGGGGATCGGGGCGCCTTCAGAGCAGCGCGT
GCGGGAGCGCGGGGTTGATCTGGGTGTCGCTTCTCGCCTAGCCGAAAGGGAAGAAGGCCA
AGGGGAAGAAGGTGGCCCCGGCCCCTGCTGTTGTGAAGAAGCAGGAGGCCAAGAAGGTGG
TCAACCCCCTGTTTGAGAAAAGGCCCAAGAACTTTGGCATCGGTGAGTAAGGAGAGGGGA
GCGCGGAAGTGTGCTGAGCGGAGCGAGGGTCGTGTTCCTGCCCCGTTGATGGGTTTCAGC
GGGTGTGGGGTCCCCCCCCTGGCTGGGATGTGGGCACCGGGTGCGTGGCCTCGTTGTCCC
TCCCCCCGAGTGTGTGTCAGCTCCGCTAGGATTCGGCTGGGCTGCTTGTTGGATGGGGGA
GCGTCGCCAGTCCCCCTGTGATCATAGGTGTTTGTGTGCAGATGATGTAAGAGAATATTT
GCTATCCGAGAATTGGTGATGACGCTTTAAACCACCAAGATCGCTGATGCACCTACACCC
TCCCAAGTGGCGCTAAGCACGAACTTGACCGGGAGTTTGAGCCTCACTTACATCGTTGCC
CTTAACTTCTCAGGACAGGACATCCAGCCCAAAAGGGACCTCACGCGCTTTGTCAAGTGG
CCCCGCTACATCCGACTGCAGCGGCAAAGGGCTATTCTCTATAAACGTCTCAAAGTGCCT
CCTGCAATTAACCAGTTCACCCAGGCCTTGGACCGCCAGACAGGTGAGTTTGTGTAAACC
AGCACGGAGACGTTTCCTGGGCAGTTAGGACTGGAACTGAGGTCTTTAAGGAGTTCTGGT
ACTTGCAGGAAACCGGCTTACTAAAATCTAGGTTATCTTGTCTGGTTTCTAGATCGCGAG
GGTGGCATAGCTGAAGTGATCGTGCATAGTCTGAGTTTTTTTTTTTTTTTTTAAGTTAAT
TTCTGTTGAGCGCACACACTTGGTGGCACAGGCAGGGGAGGGGCAGAGAGAAGGAGAGAC
AGAATCCCAAGCAGGCTCCACACCATCAGCGCAGAGCCCTGTTAAGGGCTTGAACTCACA
AACTTGGAGATCAGGATCAGGAGTCTGACACTTGACTGGGCCACCCAGGCGCCCCGTGGT
CTGAGATTTGCACTATGATAGTATTCCGGACAGTGACTTAAAGCATCATGTAGGTAGCAA
AGAGCAGAGCTTGAAACGCGAGGCTAAACTGACGTCATTCTTGCAGCCACTCAGCTGCTC
AAGCTGGCCCACAAATACAGGCCGGAGACCAAGCAAGAGAAGAAGCAGAGATTGCTAGCC
AGGGCTGAGAAGAAGGCTGCTGGCAAAGGGGATGTCCCCACTAAGAGGCCCCCTGTCCTT
CGAGCTGGTGAGTGGGCCCCTCCTTAAAGGGGGTGAGTGGTGGGGTGGGGCAGGCTGTTG
GCAGTGATGTATGAATTTCTTCACCTGGAAACACCGTGGAGAGCAGAATCCGAGCTTTTT
AACCCTGAGCCACAGCTGGGTGCGTACCATAGTAGAGCTGCTTTTGTGACCTGGGCAGTC
CCTGTGAACTGCTCATGCAAACTGTTTGTGCTTCCAGGGGTTAACACTGTCACCACCTTG
GTGGAAAACAAGAAGGCTCAGCTGGTGGTGATCGCACACGATGTGGATCCTATCGAGGTG
TGTCAGATTGGTTGGTAAAAGTCAGATTGGGCCCTCATGTCAGTACTGGGAAGACTGAAA
GTAAGCTGGAGTTTGGCTCGAGGCCCAAGTAGGCACGTGACTGCTTTCCGTTGAAAACAG
TACTGATGAGGGATCCCACCAATAGCCATTGCAATGATGTGGATTTCTCACTGAATTCAA
CTTTGAAGTGCAAAACATGAGCTTTTTAACCCTGAGCAGTTGCTAAATTAGCTTCTAAAT
TACTGCTTTTGGCCAATATACGTTCTAAAGCTAATACGGTTTTCCAGCTGGTTGTCTTCC
TGCCTGCCCTGTGTCGTAAGATGGGGGTTCCCTACTGCATCATCAAGGGGAAGGCCAGGC
TGGGGCGACTGGTCCACAGGAAGACCTGCACCACTGTTGCCTTCACACAGGTTAACTCGT
AAGTATGCAAGGGGCCCCCGAACTCCCAGGTGTCAGTAGAGGTCAGGCAGTCCCCTCCCC
CAGTACGTTTCGTTCACTTCTCGGAATTTGTTCTACCTCCAAGCAACACGTTCATCTGAA
TCTTTGCCGATGATGGTTACGAATTTCTTCACCTGAATAAGCCGTGTGGTCGTGTTGTGT
CTGAGGCAAAGGCCTTGTGTTTGGGGCTACAGAAAGGAAGTTATTCCGGTTTTCCGGAAA
GGGAACATGCTGATGACCCCCTTGTCCCTCCCGCCTTTTCAGGGAAGACAAAGGAGCTCT
GGCTAAGCTGGTGGAAGCTGTCAGAACCAATTACAACGACAGATACGATGAGGTAAGCAG
CAGCAGGACACAAAACGTTTGGGGTGAGTCAGGCCTGTCTCCGGGGGACTGGCCAGCTCC
TCCAGAGCAGTCCTACTGGGCAAAGGACTTGGAGGGCCAAGGAGAAGACAGCACGACCCA
GCATGGCTCTGAGAGCCTGACGACGACAGCCCACGCCAACTGCCTCTCCTGTCATTGCAG
ATCCGCCGCCACTGGGGAGGCAACGTCCTGGGTCCAAAGTCGGTGGCTCGCATCGCCAAG
CTGGAAAAGGCAAAGGCTAAAGAACTGGCCACCAAACTGGGCTGAGTGGGCACAGGTGAC
TTTTCTGTATATAAAAGTAAATAAAAGGCTCTTTCTCAGCCCGGGCCCGTTGGCATTTGG
GGTGGACTGCAATTTTTTGTCGTCCTAACACACGTTCGGGGTGGTGGCAAGGTCCTTATT
TGTTGTAGGGTAGAGTTAAACCTGCTGTCCAGGTTGTACGTTGATCATTTGGAAAAAGCA
GCCTTAAGACTGCTGGGTCACATATCAGGCCCAAGCCTAGACTTTACGATCATCCAGTTA
TAAGTGGCCCAGGTAGAATGACGGATACGGTACAGAGCGTACGTAGCACAGAGATTTATT
TACGCCCATAGTTGCTGATCCCACATGAAAACATCTCCAGAAATCAGCCGCTTCCTGATA
ATTTAGGGGAAGGGCTACATCTGCTAGTCTCACACACCAGAAGTCCGACGTAGGAATTTC
TTAAACCACAGGTATGACGTAGCTGCACAGAGTCCATACCTTGGGTCAAAAAGATGAACA
GTCAGGGTTCTGAAGGGGGGGGGGGACTAGAGATCCGGACTCACCATGTGACATCGTATC
GGGGACTCACCAGGTGATGATGTATTGCATGTGCTCGTTCCTCAGAGTGACTCGGGTTTG
CCCTCCAATGGGTCCCCCGGGGACGGTGCTCTCTGCAGAGATAACGGACTCAATCCACAG
TAGCTATGCCGCCAGCTTCTCCCTACAGCGGCTTGGCCAGCTGTTTCCTTGAAACCTTGC
AGAGCTTTTTAGATTTTTGCACGGCCAAAAGTTCAGTACATACCTTTCACCTGTAACCAA
CCCTGGGTTGCCTCTCTCCAGAAAGATATTCCCCTTTCTCCCAACGGATACTACGATGTA
ACTAACAGGAAATAACTAGAAAATTTCCAGGGCTAAAAGCAAGGTAGAACGGGGTATTTA
CAAAAAAAGCTACTCGATCTTCTAGGGTGGGTTGATCACAACGTACTGAAGTCAGCATCA
ATGAAAATGGGGTCTGCGCCTGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 1513..1662, 2146..2286, 2497..2576, 2867..2997, 3282..3351, 3540..3644
1001..1121, 1513..1662, 2146..2286, 2497..2576, 2867..2997, 3282..3351, 3540..3641
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved