Felis_catus Locus ENSFCAG00000002739
snOPY snoRNA Orthological Gene Database
Felis_catus ENSFCAG00000002739
Felis_catus
ENSFCAG00000002739
scaffold_214833
SNORA62
1956..2106
14863
GCAAAAGGCCCCGCTGGATTAGGCGGCCCATTCACCCTTCCGCTTAGCTTTCGCTGTCA
TTGGCTGGCGGCGGAGTATATAAGGACGTCACTTCCGGCCGCCGGCCTTTTTCCGCGCTA
CCCGGGGAGGGGTCCATACGGCGTTGTTTTGCGTGAGTCCCCTGTGGGGTTCCCGGCGTC
CCCCAAATAGTCCCAAAGGCTATTAAAATAGCCTTCCGCTGGAGTGAGGGGTGCGAGGAC
TGGGGATGAAAGCCAGCAGGCAAAGCGGGTCTATCTCCGGCTCTGCGCCCAGCCGCCCGC
ACGTGGCTGAACTCGGGCCCGCGGCTTCCCACAGTGTCCCCGGAGCGCGCGGAGGTCGTG
CTGGAGCCAGGGCACCGGGTGAGGGTGCGGGCCGGGCTGCGGCTGGGCGGCCGTGGCGCA
GCAAACAGGATCAGCGTACCACGCGCTGCAGTTGCTTCGGACCCCGGCGTTCGGCCGGCC
TTGAGCTCAGGCCCCGGTCCCGGTTTACGACAGCTATTTGGGCTGCTTGGTGTATCCCGT
TCGCGTTAAGATACCTGGCAAGGTTTTGTAGGAAATCACTTGTGACCGTAGAGAGAAATA
ATTGTGAAGCGCCCTGCCTTCAACCCGCTTGAAAATAAACTTGTTCGCATCTGGTTATTT
TTGCTCATCGGTAACTTGACTCCCGGTTGCCCCCTGGAATGTTAAGTGGCAAATCACCGT
TTTCATTTTGCTTAATTATTTGGGTGTTTTTCCCATCTCCACGCACTCAAGATGTGCCGC
AATTGTGTAATGTGTGGGATAGGTCTGTTCTGTTGGGTCTTTTTCCATTACCCTACTGTA
AAAGGTGTGGTCCTTGGGCTGTGTTCAAATAGGTTGCTTGGCTCGCCAGGGTCGTTAGAA
TGCACCTGGTCCCATAACCCACTGAAATGAAACGAAAATAGCTGGATGGTTAACCGTTGT
TTTCCAGGTTCCCCGTCGTAACTTAAAGGGAAACTTTCACAATGTCCGGAGCCCTTGATG
TCCTGCAAATGAAGGAGGAGGATGTCCTCAAATTTCTTGCCGCAGGAACCCACTTAGGTG
GCACCAACCTTGACTTCCAGATGGAACAGTACATCTACAAAAGGAAAAGTGATGGTCAGT
TGTTGCTTTGATTTGGGAGGGAGGGCATTCGACTAAGTAATAAATGAAACCAGATGTCTA
CATCGGAAGTAAGCTTTGAGACTTAAGTGAACATAGGGCACCTGGTCAACTCAGTTGATA
CAGCATGCATCTCTTAATCTTAAAAAGAAATTTTTTTTAATTTTTTTTGCAAAAAACAAA
AGCGTACTGGTGGTTTTTGGAAGGACCGCTTTCTGGGCTCCAGTGCAAGAGTATGTCAGT
TGATAGGTTCTGGGACTTAGGTTGGGCCATGAAGGAGCTGTGAGATGTATAAATGATGAG
GAAGCTCATTAGTTTATCTTCCATAGTGTCTTGTATTTCACAGGTACTGACAGCAGGTTC
ATTTGAATTTTTATTTTTTTTAAGATCTTTGTTTTTGAGTAATCTGTACTTAATGTGGGG
CTCAAACTCCTGACCCCAGGATCGCATGTTCTAACTGAGCCGGTCAGGTGTTCCCTTCGT
TCAACTGAATTCTGAGAGTAAAGTTGAGCAAGAGCTAAGACCTTAATGAGGAGGCTTGGA
AGGTACTAGAAAAGGGAAGGTAGGTTGTGAAGACTTTGGAAGGTACGTTGGGCAAGGCAG
TGCTTCAAGCTCAGATGGAGCCACTGAAGAACTTAAGCCTGGGGGTTGTGTGCTGTGAAG
CAGTTTGGGGTGAAATCTGGCATTGAGACAGGTTGTAAGGAAAGTGGGTCTGGAGACCAG
GAGGTGGGTGAGAACTTACCGGAATCTGGATGGGGCCTTGATGGAGGCTTAGGGCAGGAA
AGGACCAAGAAGATGCACTTTGTCTACCGAATTAAGGCTGCACACTATTAAAGCTCAAGG
TGGAGGCCAGCCTTGGCCGATGAACTTCTGAGTGTCGGAAGTGTGCTAGATAAATTGCAG
GATTTTCGCTAACACCAGTAGAGCCTGCCTCTGTGACTGGAGATTGATAGTACTCGCTGC
CACATTCGGCCTTTTAGAACAAAGTCTGCTTGAAAATTACGTCTGGTACTACAAAGCTCT
CTGCCATCACCTAGGTATCTACATCATCAATCTGAAGAGAACCTGGGAGAAGCTTCTGCT
GGCAGCTCGGGCCATCGTTGCCATTGAAAACCCAGCTGATGTCAGTGTCATATCATCCCG
GAATACTGGCCAGGTTTGGAAACAATATGCTTGGTTTTTAGAAATCTTGAATTGCCCGGA
TTCAGTGTTTTCGGTTTACACGCTACTTGGCATTTGGTAGAGTGTCGAGCTTTGTTTTTT
CCTGTGTGTTTTCTTGTGCCGCTAGGTACTGACCTAATCCTGTAAAAATGGCTTATCACG
TGTCTCTGTAGTCAGACCTTTCTCTTGACGATGATGAAACACTGGGTCCAAGCTTTGGTG
TCAACTCCAGGATTTTTCAGAAAGGTTTTCTAACGGTGCCAGTCCTCATCCAAGTCTCCA
AGCAAGAGTAGAAATCTTTGCTAGCGTAAATAACTTAGTTTTTGTAATAGCCAATGGGTA
AAACTTGTATGGCCCCATTTCTGTTTTGACAATTCTTTGTTTTTCTGTGGAGAAAACCAG
TGGGTTCCTTAAAAATTGATTTATGGTTGAGCCTTGCACAGCACGGTGGATTAGGGGCAC
CAACCCCCAACGTGGTCAGAAATCTGTTTTAGCTTCTGGCTCCCCCAAAACTCAGCTGTT
AATAGCCTTCAATACCTTTGGAAGCCTTACCGATAGCCTAAGTAGTCAATTAGCACGCTT
TGTATGCTGTATGTATTACATACTGTATTTTAAAGAATAAGCCAGAAGGGAAAATACTGT
AGAGTGCTGTTAAAAAAAAAAAAAAATCCACATGTAAGTGGCCCTGAAGAGTTTAAAACA
TGTGTTCAAGAGTCCACTACAGGAGGTTTAGCAAGGATTTCATTGACCCCAGTTCTAATT
TGAAAAAGATGTTTGACTTGGATTTTGACAGATGTTTAAATCGTGTAGTAAGACAGGTTC
GTTTGTATTGTTTAGGTTGACCATAAAATTGATTGCCACGAACCAAAGATGTGTTTTGCG
CAGGGGGTTATTCTCCAGAGGCTGGCTTGTATCAGGACCCCTAGTTTGGTGCACGGTAGA
AGACTTAAGGATTGCTGTAGAATGGACCCAGTGACCACTCTCATGGCTTTCCTCAGCAAA
GATTTACTGAGCGTCTGTATTGGGCAGGCAGTGTTGCAGGGGGCTTGGGATGTAGCAGAA
AAAAACATAACTCTGCCTTTTTTAGGGATGCAGGAAATAAGTTTTACGGGGTAAAAAGGA
AGGGTATGTTGCTGTGGTGCATAGGGTAGCTGCGATGGAATTCGACCAGAGCAGAGAAGT
GCTTATTGGTGTGTCGGGCACTGTTGTGTGCTGTGTTGATTCGTCTTCACGGCCCCGTGA
AGAATGTGGAAGCATACGAGTGACCTGCCCGGGTCACTCAGCAGAGTGACCTGCCCGGTT
CTTGAAACCAGCCGGTGGGAGTGGGGAGAGCATTCCAGACAGGATCAGAGGGCGGGGCGT
GCTTACTGTTTCTGGGCCCCAGTTCTGCAAGTAGTTGTCGGGTAACGCGGAGGACAAAGA
ATTACCGGGTGTCTGAAGTGCTTTGATGTTTTCACTGTCGGAAGGGAGCCGCTTCGGCGG
TTGCAGACCCGGGTGTCAGCACACGGACGCTTGGGGGAGTTCCTGCGATGCCATTTCTCG
AGCGCTGGTAACTCTCGATGTTCGTTCTTCAAGCGAGCTGTGCTGAAGTTTGCTGCTGCG
ACCGGAGCCACTCCTATTGCTGGCCGCTTCACTCCCGGAACCTTCACTAACCAGATCCAG
GCAGCCTTCCGGGAGCCCAGACTTCTGGTGGTCACCGATCCCAGGGCTGACCACCAGCCT
CTCACCGAGGCGTCTTACGTTAACCTGCCTACCATCGCTCTGTGTAACACAGACTCTCCT
CTGCGCTATGTGGACATCGCCATCCCTTGCAACAACAAGGTAATAACCGCTGTGACGTCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCCCCGTCCCCCACTTCCATC
AACCCTCGGTTCTCTGTATTTAAGAGTCTCTTAGGGCTTGCCTCCCTCTCTGTAACTTAG
TTTTCCTTCCCTTCCCCTGTGGTCTTCTGTTAAGTACCTGTCTTTGACTTAACTTCACTT
AGCATAATACCCTCCAGTTCCGTTCACGTTCCAAATGGCAAGATGTCATGCTTTTTCATT
GCCAAGTAGTCGTTGTATGTATGCACATCTTAAAGTCCCTGTTAGTTGGAAGGCAGTGCT
GCTTTCTTGGGAGTTTCCCTGCACTTCCCTTTTGCGTAGGGAACAGCTGTTGTGGAAGTA
GATTTAAATAATTGTAAATAGGTGGTAACCCTGGAAATACTTTCCCTAGGTCCGACCCAG
TATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
TAGTAATTCTTGCTACAAGTATAATTCGAGTGTGTCAGAACTTTAAGGAGAAATTATTTA
AGCGGCGTGTGTGTTCGTCTGCTCTTCTCTGTATTTCTTAACTGCTTGGGCCTCTCGGGC
ATTACTAGGCCTTTCTGTTTTCAGAGCAACTGGATGAACTGCTATGAAATCCTAAAAAGG
TGGGTTGCCTGTGATTCAAATCGGCCCGGTTTCCTGGGTCTCAAAACCCTGGTTCCGTGT
AAGAATCCCCCAAAGAGATGTTTTAATAGCAGTATCAGTGTCCAGGCACTCACAGGTATT
TCATTTGATTGGTGGAGTCTTGATAGTTGTGTTTTAATCCCCCTGGTTCCAGTGACCATC
AAGATGGAGACGAATTTCTGGAGTGCTCTGTTAGAAGTCACTCTCTGCAAACCAAGAGAC
GGGTCTCCTGTCTCTTGGTACCGAGGACCTGGATGATGGGACAGATGGGTGGATTGGGGA
AGGACGTGCTGTTGGGGATTGACCAAGCGCACTTGCTAACACCTGGCGCTCCCGCAGGGA
GCTCACTCGGTGGGTCTGATGTGGTGGATGCTGGCCCGGGAAGTTCTGCGCATGCGTGGC
ACCATCTCCCGTGAACACCCCTGGGAGGTCATGCCTGACCTCTACTTCTATAGGGATCCT
GAAGAGGTAAGTTTGCTCCCCAAAGGCTTGTGGACGCGTAAGTAAATCAGACCTCTTGGT
TTGTGCTCCAGAAGTAAAATCTACTGGTCCCTGTACGCTTTGTCTTCACCAGATTGAAAA
GGAAGAGCAGGCTGCTGCCGAAAAGGCTGTGACCAAGGAGGAATTTCAGGGTGAATGGAC
TGCTCCAGCTCCTGAGTTCACTGCTACGCAGCCTGAGGTCGCAGACTGGTCCGAAGGCGT
GCAGGTGCCCTCCGTGCCTATCCAGCAGTTCCCCACTGGTACGGGTCCTGATGCTTCAGG
CTGGTTTTCATCCCAGTGTGCTATAGCTGAGCTGCTAACTTGACAGATTGTGGAGTTGGG
TGTTTTTGAAGTGGTTTGGCCTCAGCTGTTTGTCCTTTGAAATGTGTATCTGGTGGGATT
CAGGGCTACGGTGCGCTCGGGTGGGGGTGGGGGTGAGGGTGACGAGAACACTGAAGGGGC
CTGACTGTTCTTTGGTGTTTCCTTAACAGAGGACTGGAGCGCTCAGCCCGCCACGGAAGA
CTGGTCTGCAGCCCCCACTGCTCAGGCCACCGAATGGGTGGGAACCACCACCGAGTGGTC
TTGAGCTGCTCTTCTGCGGAGAAGCAAAATGGAAATAAGGTTGACGGAAAATAAACCGTT
TCTATAAGTTGGGTCCATGTCTGTCTGTTTTGCATTCCAAATCAAGATGCCTGGCATTAC
TTCAGGTCTTGATGTTCCTTTTACTTCTAAAGCCCACTCTTTTTTTTCCATTTTTTTAAA
TAAAATTTTGTTTTTTGATCATTTATTGTCAAGTTAGCTAACATATAGTGTCTACAGGGT
AGTCTTGGCTTTAGGAGTAGATTCCTGTGATTCACTACTGAACATACAGCACCCAGCACT
CACCCCATGAAGTGCTCTCCTCAGTTCCCGTCTCCCCCCCCCCCCCCCCCCGTACCACAC
ATCCAACAACCCTCAGTTCTCGGTAGTTAAGAGTCACTTAGGTGTACCCTCCCTCCCTGG
GATTAGTTTTCCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGTAAATAGGTGGTAACCTGGAATACTTTCCCTAGGTCCGA
CCCAGTATCGTATTACCATCTGCATTGGTAAATTGTGTCGAGTCAGTTCTGCAGGAAATT
GATTCTCAGTCACCACCCTGCTGTTGTGCCCGTTACGCAGCCAACCTTGGATAACATCTG
GCATTTGAAAAGCCTGCCTAGGGCCCGGGTGGGATGCCTTCTACTCTGGAGCCACCAGAG
GGCCCCCAGCCTGTCACCAGGTCAGCTTGCCTACAGGTTCTAGGAGGGTTGATGGGTGTA
TGGAAAGGGCATTAGATGATGATCTCCATATTTGCCATTTACTGCACATTTTCAATTCTG
TTTAAAGTGTCTAGCAGCTTTCCTGATTTCACAGTAACATTTGACCCATTAAAACTTCTC
TTAAGGGGAATGCCTGGGTGGCTCAGTCGGTTAAGCATCAGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 2174..2292, 3873..4118, 13137..13265, 13372..13537, 13769..13863
1001..1133, 2174..2292, 3873..4118, 13137..13265, 13372..13537, 13769..13860
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved