Felis_catus Locus RPL3
snOPY snoRNA Orthological Gene Database
Felis_catus RPL3
Felis_catus
RPL3
scaffold_166251
SNORD43, snoU83B, snoU83B
1497..1560, 4904..4997, 6382..6475
8244
CCAATGGTGTGAGCGTGCAATGGCCAGGTCCAGAATCAAGTAACAGGACCGGGTGGGAT
GGAGGTGCAAGGTGACGTATGGGTGACAGCGTGTGTGCCCTCCCCAGCAAAAAGGGTGTA
TCAGGCCTTTGGGGGGCAGCCTCGGGAGTTAATGCTTAATCCCCAGGAAACAACAGGGAG
CCACGGGAAGTAACAAGATAACATGTGATTCTTAAAAAGATTTCGAGAGGCAAGCCTGGA
AGCAGGGGGAGCAATTAGGAAGCTCGTGGGTCACCGTGGGTGGGGGGAGGCAGGCGGAGA
TCAGCAAGGGCTCCTGAGGCTGGAAGGGCGAGTCAGGGACGTTGGGCAGCTGGACCCGTG
ACCGCAGGTCGTGAGGCGGTTTTGTCGCCTCACTGACCATCAGTAGCAAGCGCGGGCCAC
AGCACCTGGACACCCGGAGTCATGGCCCAGACGGGGCTTGAGGGACGGGTGTCCGAAATC
AGAAAGCAGTAAAGGCAAGTTGGTGTCGCGGAAGCAGCTCTGGGTTGGGAGTCAGGCGGC
CCGGTTTTCGGTTTTTTCTCTCCAACTCTGAACGGGTGGGAGCGGGGCAACGCGTCCCAA
GTCGGTTGCCCGCCAAACGGCCAACACCGCGGATCCGCTGTGTGGGACGGAAAGGGGATG
TCACGTGTGAAGGCGCTTGGGCGCTGAAACCCACAGCTGGGTTATTCAATCCTGGAGGGG
ACGGCATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACTCTGGG
CGAGGACGAGCGTGCGTGGAAAGGGCGCCCCGTACCCGCCCCACGACCCGGCGTCCGCCG
CGGGCGCGCGCTCGCACGCCGGAAGGGGCGGAGCCAGGCGGGGCTTTATAAATGGCTCGC
CGGCAGAGCCCCGACCTCTACCGGCAGCATTCGGCGGCGGGAATGGTATGTGTTATCATG
GCGCTCCCCTCTTTGTTGGCGCGGCGGCACGACTCCATCCGCGGCGCATCGCCGCCATCC
CAACTCGGCGGGCGCCGGGGGCCTGCTCGACGAGCATGGGAGACTCGGCGACATCCCCAA
CCAGGCCTATTTCTGGAAAGACCCGAGGCCTGTGCTTGACCTGGGGCCCGCCAGGCGGCT
GGCGAAAGCCCTTGGGCCTGGCTCCGGTTTGGAGGCCCCGAGCCCGAAAATTCTCAAGAG
CCAGATAATTTTCCGGATCTCGCCCTTACCGATTTAGTGTTAATCCGGTTTAGAGTCTGA
GCACGTAGGCCAGGAGGCACTTGAGTGGGATCGCCAGGCACTAGTCGTGCTAACCTGGGA
GGTGCAGAAATCCAAGTAGGGCGCGGGAGGGGAGCCTGGGGTAGGGGTGCCGAGGCCTCG
GGCTGAAATGGGTGGGACGGTTCGTACAACCGTAAGGCCTCTGGAGTTCCGAGGAACCAC
AGATGATGAACTTATTGACGGGCGGACAGAGACTCTGTGCTGATTGTCATGTTCTGATTT
GGCTCTGTCGGGTTCTGGTGGCCTCTACGTGTTATCAGTCCGGCCTGGGGAACCTGTAGT
GCCAGCTGCTTGTCCCAGAAGTCTCTTTGTGGTCAAACTGTTGCTGACTCGACTATAAAG
CCACCTGTGTGAAGTGATTTTAATGACCCCTCCCCCCCACCTTGTGTGTCTTTGTCCTGT
TAAGAAAGTACGTTTGCTTGGGTTACAAAATGAGGTTTCGAGGCAAAGATAGAACTCGTT
TAGGATGTGTGGCCCTCTAAGCAAGTGAACCCAGCCCCGCACGTTAGCATGTTTATTCAT
GGGGTCGCTGGTGTGGACTCAGCGTTCAACTGAGGCACGCTGGGCGTCGGAAGTGAGCTA
CTTAGATGAGCCTGAGTGCTAACATGGATTGTTTCCTCCTAGTCTCACAGGAAGTTCTCC
GCTCCCAGGCATGGGTCCCTGGGCTTCTTGCCTCGGAAGCGCAGCAGCCGACACCGTGGG
AAGGTGAAGAGCTTCCCCAAGGATGACTCTTCAAAGCCCGTCCACCTCACCGCCTTCTTG
GGCTACAAGGCCGGCATGACTCACATCGTGCGGGAGGTCGACAGGCCAGGATCCAGTAAG
TACAGGCTGCATCCTCGGAGCTGGTGGTGGGGGGGGGGGGTGGTTAGGAGCCGAGGATGG
GGATGGACTAGAGTTGGGGCAGACCATCTCTTGGTGGGATCGGTGTCTCGGGCTGTAGAT
GGCTGGCATTGCTGTAGGTGGAGGGATGTGTTGAAGTCCGGGAACTTTAACGTGAGTAAG
TTTTAAAAGATCCACAGCATAGGAGTATGCCAGTTTGGGAGATAGTTCCTGTGAGCCTTA
ACTCTAAAAGCCTGAATACTGCCCGTGTCCCTGGTTGTGAAGTGCAAAGTAGAAAAATCG
CACTGCCTTAGAGTCCTGATACTTTTTTGAGTTAGAAACACAAAACACATGCGGGAAGTT
GGCCCCTGGGAGTGCAGGTTGCCGATAAGGACCCCACTTCTGCAAACTTCCTGGTTACCT
CAAGCACGTTGCCTTCTTTAATTGAAGTGGGCACTTGCAGACGCAGCGTCATAATCCCTC
GGCGACTCTGGCTGTCCCCCTCCGGTCTGACCGCCCTCTCTTCCACAGAGGTGAACAAGA
AGGAGGTCGTGGAGGCTGTGACCATTGTGGAGACCCCGCCCATGGTGGTTGTGGGCGTCG
TGGGCTACGTGGAAACCCCTCGAGGCCTTCGTACCTTTAAGACCATCTTCGCTGAGCACA
TCAGTGATGAGTGCAAAAGGCGCTTCTATAAGAACTGGTAAGGGACAGGGACGAGGAGGC
TATGCGCTCTGTGGGTCGGGCCCTGTGCGGGTTTTCTCTCTAGCAGGGGAGGAACTACAA
CTGCTCTGGCGTCTGGTTTAGTTGGTGTCCTGAGCAGAACAGTTCCTGGGGACAGACCTT
GAGCAGCACCTCTAGACCGTCCTGTTCAGCCTAGTGGGTGTGGACTGAGAACTCAGTAGT
TCTCGTGTTCTTTTGGTTGCTGGGAAGTGTGGAGAGTAGGGCTAGAGACTGAGAGAGTGC
CCAACTCCCCCAGTCCTCCGTCCGGGAGCGTGGTCGGGTTAATGGCTAAGTCGGAGCAAG
AATTAGTGAGCGTTTGAATGTTTGTGACTTGTATTAATTTTGTGGACCTCTGCTCAGCTC
CGCTCGGCTCTGCCCGATGAGCTCCATCCGGGCTCCGCTTGCCGGTGGAAAAGGCTCCTT
AGAAGCCGGCAATGAGCCCCATCCCTATGTGGCGCCAGCGTGCCTTCCGCTCACCCCTTG
GAGGGGTGATGAAGGCCTGCGCCCCGCCCCCTCCCCAACTCTGCTCTGCCCCTGAAGGCA
TAAGTCCAAGAAGAAGGCCTTCACCAAGTACTGCAAGAAGTGGCAGGATGACGACGGCAA
GAAGCAGCTGGAGAAGGACTTCAGCAGCATGAAGAAGTACTGCCAGGTGATCCGCGTCAT
CGCCCACACTCAGGTGAGCGCTCGGCAGGGCGCACGAGAGGGGGACTGCGCCAGTGCTTC
CTGTCTAGGGAGACGGGGTCCTACTTGAACCGAGCCCCCCCAGTTCTCTTCTGACCTGAT
GCCTCACCTCAAATGGACTGTGTAGGGATTTTGGAGGGATGGTAAGGTTGGTTCCGGTTC
CTTAAACTTGTCGACGGATGGGCCAGCGAGCAGCCCGGGGATTGCTTGAAGTGATGCGGC
GACACGGTGCGCCACCTGCCCTGGATCCCCAAGGCCAGGCTAAGTCTATTAACCTGAGAA
GGCAGCCCGGTTCCTCCAGGCCTAAGGGTTGGCTTTTCTGTCGCCAACAGAGGGCGCTGT
GTCTCCAGGCTTTTTATTTGGGAAACCGGGCCCCATTTTAGGAAAAGCGGTGGAAGGAAC
TAGTGATTCTTTGACATTGTGAAATGCTTAACTGAAAATAGTAGTAGGTTACTGGCTGTT
TGCGCTTCAAATCTGACTTGCCGTGACCCTTTGGCTGTAGAATGACTACGTCCTCTGCAG
TTTGCTTGAGTTATTATTCTGGGTATACACCCCTGATTGTTAAATTGTTTAGTTTCAGTA
TGGTTAAAATGACCATATTGGCTTAGATTTGTAGTGTGTGTCCGTTACTGAAGAAAGTTC
CACAGGACAGCACTGGGCCACTCTTAATGAAACGCTTTAGGTTTGAATTCTTTTTTTCCC
TAATTTTGCAGCTTATCTCTTGACTGAGGTGCTATTTCCACTCTCCCACAATGTGAGTGG
CTTGTTGACGGTCAGTAGAGCCAAGATAGATGGCCAGGGTAAACGAGGGCAGTATTGGAA
GCAACCAGAAAGCATGATGATCAGGAACATAGGGCTAGTTGGTCCCAGGATCTGGTCAGG
TCTGCTTGTGTTGGTGTGGCCCGTGTGTATTAAGGATCAGTCCATCCTGATGGTGAACTC
CGGCATCAGAATTGAAAAGGGGAATGGTACCTGGTAGGGATTTTAACACAGGAAGGAGCC
TTTTCATTTTTGCCAGTAGAGAAACATGCGGTTCAAGGTTGCCAAACTGTTCTGCCACTG
GAGGAGAGTTGAAGCTCAGGTACCTGAGCCGTATCGATTCCCTCCTAGATGCGCCTGCTC
CCTCTACGCCAGAAGAAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGGTGGCC
GAGAAGCTGGACTGGGCCCGTGAGAGGCTGGAGCAGCAGGTGCCTGTGAATCAGGTGTTC
GGGCAGGACGAGATGATCGATGTCATCGGCGTCACCAAGGGCAAAGGCTACAAAGGTGAG
CTTTGCAGTGGCCCAAGTGGTGGTCAGATGCGGTTTCAGGTCCAGATCTTTGGCGATGAG
GCTCTGGAAGGAGCGCTGGGCACATCTCACGAGTAAGATGGCAGAAACTTTCCTCCCTGC
CTTGTCTCTGGGAATAGCCCTGTGGCCAAGTGGCAGGGAGGTAGGAGGACTGGGGGTGAT
CTGGCCATACATCTGAACCTTTACGTGTGGAGCTCACTGCAGAAGGCGGAGGGGACTCGG
AAATTGGGTCAGCCTCCGACAGCGTAGAACTTGGTGAATGCTGTGAAGTGCGCGTGTTCC
CATTCTAGCGCACGGCCGGTTCTCCCAGGCCTCTTGAGTTGAGAACAGGTTTACGTCTTG
GCAGGTGATCCACTGGAGCGAGTAAGAGGGGTTAGAGGGTCACGTGTATGTTAAGCCTTC
CTGTCCCTCACTCACCTAGTCCATGTGGGTGTTGACTGTCCATACTCAAGTGTCGAGTGA
ACTCAAATTGGGCACTCAGTGGGAAAGGGCCACTGGCAGGCGTTCTAGACGCCCCGGTAA
CAAGCTTGTGTCTGTTCTAGGGGTCACCAGCCGCTGGCACACGAAGAAGCTACCCCGCAA
AACCCACCGAGGGCTGCGCAAGGTGGCCTGTATTGGGGCCTGGCATCCTGCCCGAGTGGC
CTTTTCTGTGGCTCGGGCTGGGCAGAAAGGCTACCATCACCGCACCGAGATCAACAAGAA
GGTGAGGTGCCAAGGGGGTTCGTGTGGAGACTTTAAACCTGGAAGGGAGAGACGAGCCCA
GTGTTGGGAGTGCAGTTTCCATTTCCTGTTAGCACTGCTCCGTTGTGCCGTAGCTTCCGG
ACTGCACTTGGACCGGAGTTGCTCACCTTGTATGATGGGGCACGGTTTTGGCTCGTGGAC
GTCAGTGGTTTACAAGGTGCCATCGAAGGTGGTTCTGGTGCAGCTGACCCTTCGAGTGAC
CAAAGATGAGAGCCACGTCTGGCCTTTCCTTTGCGGTTTTGGGGGGGCCACTGTCTCCCA
ACACGTGGCGATATCTTGAGGCCCAGCCAGCCTTTCTTTCTGCTCCTAGCCTGGGGTGCC
CTATCACTAGGACTGAGGCGATAGCTGCTTTCCTGGAGTCTGTCTCTCCTTTTAAGTTTC
TACGGTCCATCTCTTATGTAGATCTACAAGATCGGCCAGGGCTACCTCATCAAGGACGGC
AAGCTGATCAAGAACAATGCTTCCACCGATTATGATTTGTCTGACAAGAGCATCAACCCT
CTGGTGAGTAATGAGAACTGTTTTCTCAAAGCCTCAAGTCCTGGCTCGGGCGGGGATTTC
CTTCTTCTTTGTGAATCTGCGCCAGACCTCACCTGTGGGGTGGGACCCTGGTGCTCTTGT
GTCCTGGCTGACTCACCGAGGCTGTGTTTTCAGTCTGTTAACTGGTCTCGCACAGACTGT
ATCCAGCCGTCTGTTCTTGTAAGTGGCACGTCTTCAATGCCCTGGTTGGGGCTGGCCGGT
GAGAAGTGGGATCTCAGACCCAGCTGTTCAGTGATGAGGCTCTGGAATGAGCGCTGGGCA
CAGCGCCCGAGTCCAACTGCGGAAACGTTCCTTGCTGCCTTCCTTCTGAGAACAGCCCTG
TGGTCGGCAGGTGGCAGGGGAGCACCTGAATCTGAAGGAGTCCTGTGTGTTGTCTGATCG
GTCTCTAGCCTTACGCTTGCTCTGTCCCGATCTGATGGCTTTGCTCTTTCCAGGGTGGCT
TTGTCCACTATGGTGAAGTGACCAATGACTTTGTCATGCTGAAAGGCTGTGTGGTGGGAA
CCAAGAAGCGAGTGCTCACTCTTCGCAAGGTGAGGCTGGCGGCCCTTCCTGGTGGTCAGG
GTGTAGGCGGGGCTCGGGCCTCCGGTGGAGGAGAGTCGATAGTGGACACAGGGCCACACT
TCCTTGGGGAGTTCAAAGAAATGGGGGACAGGGCTTGGTCTTCGCTTGAATATGAGCTTT
GAAGTTCTGGGAGGAGGGATTTCAGTCTGGCCTGGCCCAGCTGTTTGCTTCTGTTTTCAT
GTGTTTCCTACATCGCTCTGGCGTCCAGGGGGAGATCCTTGGGTAAGACCAGCTAGAGTA
GAGGTGGTGCGGGAGGGGGTTCCTCTGGGCTCTGGCGGGGCTGTGATTGAGACTGGCGAT
CCTCTGCCCTCGCAGATGAGGGGCCTGTGAACTGTAACTGACCTTTCCCTCTTGGCCCAC
AGTCCTTGCTGGTGCAGACCAAGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTTAAGAAAGACCGAATTGCAAAGGAAGAAGGAGCTTAACGTCAGGAGCAGATT
GTGCAGCTGGTGGCATCTCAGTAAAACTAGTTTTCCAGTGACCCCCTGCCTCCGGTTTTG
CTTCCCAGTCTGGCCGCTCCACTGTGGCCACAGGAGGGTTCTTGTGCTTTGAGAGTTGTT
GCCCTTGGCTCCTTGGCAAAATGTCACGTTTTTTGCCCTACCATTTTATCTGGCCGCGTG
CCTGGAGCAGGTGGGGCTTGATGGGAGCTAGAAGCGGAGCCCGGGTCTGCCCCTGAATTG
TCGAAACTGGCCTGGGGCGGCAGGCTTTGTGCAAATGTGTCCTGTCACCCGGTGAGGCTC
TGCTGTAGAGGGTGATTGTGTTTGCACAGCTCGGGTGGTAACACCGCACGGGGAGGGAGG
CAGTGAGGATGTCATGTTCCCCGTTGGCTTTGGAGTTCTGATGGGCACGGCAGGGCCAAC
CCTGGCTTTGAGTATAAGAATAAGTAATTTAGTTAACTAATCCACATGGGATACATGGGA
TTGGATTCCAGTTGGGGCTTGTTGAGGTTCTTTTCTAACCAGCCGGGTTTTGACACGGGT
GGGGGGGTGCCCCGCACTGAAACTGGTAGAACGTGGGAATGTACCCTGAGGAAGGTTCTG
GTTAGTTGCTCCCCCAGCTTTGCTTTACAAGGTTGAGGACGTGGGCATGCAGAGGTGAAA
TTCTGCCCAGCTGGGAAGCCAGTGGGACCCTTCATTGGCCTAGAGTGGTTCAGCCTCTAC
CCTGTGTATCTGTCCTCCAGGCTTGGGATCCCCACAGTGGTGGGCAGTGGTGTGGCTGCT
CTAATCTCTGATTTCCGACCCCCGTGACTTCAAGCCTGTGAGTTCTAGCACAGCTGGCAG
TCCAGGGGTGTGTCCAGGGCCAGGTAAATTAGAGGGGGCCCAAGTTGTCCCTCTGGCTCT
CGGTTAGCATGATGCCCGCATGAGTGGATGAGGCCGAGAAGAGCTCTAAGCACAGGGCCC
TCCCATCATGTCCTCTGCCTGGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1001, 1003..1004, 1962..2154, 2688..2856, 3417..3552, 4668..4854, 5420..5580, 6021..6122, 6593..6688, 7082..7105, 7209..7244
1001..1001, 1003..1004, 1962..2154, 2688..2856, 3417..3552, 4668..4854, 5420..5580, 6021..6122, 6593..6688, 7082..7105, 7209..7241
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved