Felis_catus Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Felis_catus EEF1B2
Felis_catus
EEF1B2
scaffold_162460
SNORD51, SNORA41
2517..2594, 2883..3016
4534
CCCGGGAACAAAACGGCCTCGGCTCCACAAAGGGGAATGACCTGCATTTCCCTTGCACA
GTGAAGGTCACCCACAAGCCTGTCTCCGGGCCAGCGCTCCCAGGGCTTCCTACTCCTCCA
CCACCTTTCTGCTCCGAAAGACCAGAGACCATGGCTAACAGCCCTCACCTGCCGGCTCTC
GGGGGTGCCGGAGGCGGGGTGGGACGCGGCACCCAGTCAAGGACAAGAGTAGAATGAGTC
ACCTGGGCCAAAGGAAACAGTCTCGTCAAGAAATCAACTCCTGTGGCAAGAGGCACCTCA
GCCTTCTCACCCAAGCACGACCTCACCTTCCCCCTGGAGCCGCCGAAGCCGCTCTGCAGA
ACTGTCTGCACCGCACCAACCCCCTCAGAGAGACCGGCTTGCTTATTCAATATGGCGGCC
TCGGCTAACCTCGCCCGCCGGGCCCGGAGAACGGGAAGCCAGGAGGGACTAGAAGCCCCA
GATTCGACAATTTCCCCCGCTCAGGTTGAGTTCGGCAATTTCCGTCAGCTGGCCAGGGGG
CGGGGCGAAGGGCCATTCGGTTGGAAGGGGCGGGAGCGGGGGCGGGGTGGGGGTGGTAGA
GCTTGGAACCGCAGTTCCGCCGGAAGTAGTCAGGCTCCTGAGGCCGGGCGTTTTCGGTCA
TTTCCGGCACTTCAAGGGGCGGTTCCTGTAGTGTTCCGGGGCCGCGCGGTACTTATTTAA
GAAATACCCTTTTGTATCTGTTTGTTTCTAAACACAAAGGCCTGCGAGTAACACGTGGGC
CGTTCAATTCAGAGCCACCCAGTTTTACATTGAGGATGAGGAGATTAACGTACTTTGACC
TTTAACCTTCGGCCCCGTGCGGCAGAGGGAAACGCCTACGTCTCTATATAAGGCCTTTTC
CGGCCTTCGGCGGCCCCTTTTCCCTTTTAGCGCTAGGCGCTCGCTCCCCGCGCTCGCGTT
CTTCCCCCCGCTGCTGCCCCGTTCCGCGATCCGCTGGCGCCATGGGTTTTGGAGACCTGA
AAACCCCCGCCGGCCTCCAAGTGCTCAACGACTACCTGGCGGACAAGAGCTACATCGAGG
GGTGAGGACTGGCTTCGGGCTGGGGCCGGCCTCCTGCGGTCGGGCCACGTGGCGCGGCCT
CTGCCGCCGCTGGGGGAAAGGCAGCGGGCCTGCGAGGGGTGAGGGATTAAACGTGTGCTT
TCTTTCCGTTGACGGGGTTCAGCCGGGTTTTCCCGCGGCTTTACTCGGTTAGCGAGTGTA
AGCCTGTAGGTCTGGGTTAGAGGTTACAATCTTTGAGGTCCACCAAGTAGCAGGGATTTC
TCGGGATAGCGCAGAGGACCAAACACGTGGTCCCTGATCTCAGGGAGTTTACTGAAAAAC
CGGGCAGCTTAGGTTGCCAGGTAGCAAATGGGCCAGTTCCCAGGAATAAGTTAGACAGGG
GTGGCGTTTGTCATTTATTTGCTGGCGTTGGTGGGTTTTTTTTTTTTTTCTTTTAAAGGC
GAGTGTAATTATTTTTGTGTCCGCGGCAGGTATGTGCCATCACAAGCAGACGTGGCGGTA
TTTGAAGCAGTCTCCGGCCCCCCACCTGCCGACTTGTATCATGCCCTACGTTGGTATAAT
CACATCAAGTCGTACGAAAAGGAAAAGGCCAGGTAAGATTATCTTGGTATTTGTCTGAAG
AGCAGGATGCTTTCTAAACTTAAACCCAAGATTTAACACCTGACCAAATGGGACCCAGGC
TACTTTAGTTTTGTTGGGATATTGTGAGCTAAGTATCTTTGTGACTTGAGAAGGCCAAGA
GACTGAAGTCCTCCGTTTTTTCACAGAACAGGTAGAACATGGACAACAGCAGTTCAACTT
TTCCCCACACTGCCCAGACAATGTGCCTGGACCCTGACCTGGGGGGCCCACCTCTGGGGT
GAGAGGGTGGCTCATTCATTCAGTACTTGGCCATTCTTCTGAAACTGCCAACGAGGGTGG
AAGTTTGGGGAAGTGGACTCCAGTTCACTAAGAATGGAACTGAGCATACTTAATGAAATC
TCAAACTGAAATATTCATACTGAAAGAGTAAATCCTAGTGAGTATTGAATGTAATAACAT
CTCACATGCTACTAATGTTTGTTGGGTGAGGAGGTAAAGATGCAAAAGTATTTATCTGGG
AGTGGTTAGGGGTAAATTCGTAGTACAAAAGGGTTCTATTGATAAATAGGGATGGAAACA
TGTTCTGGCGTGTGGTCTGAAAAAGAACATCGTACCCATTTCATCGTGATTGAACTTAAA
AAATTTTTTCAAGCCTTCCAGGAGTGAAGAAAGCTTTGGGCAAGTACGGCCCTGCTAATG
TGGAAGACACCACAGGAAGTGGAGCAACAGATAGTAAAGACGATGATGATATTGATCTCT
TCGGTTCTGATGATGAGGAGGTATGACATACATGAATACGTATGTTGAGCTTAGTTGTAG
GCTCTGGTGAAATTGCCTGGATTTGAATTCTGGTTTCACCGCTTTGTTACCTACCTGACT
TAAAAATGATGAGTAAAACCAAATCACCATCTTTCGGCTGAGCTCGTGATGGATTTGCTT
TTTTCTGATGAGACTGGTCTTTGTTGTGATGGTCCACTAGCTTTTGAGCTGAGGAACAAC
TAGCTTTGTGAAATGAATTTAATTTTTCTTCATAGGAAAGTGAAGAAGCAAAGCGGCTAA
GAGAGGAACGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAGTAGGTCATTTTATAATT
TGTGCTGCTTCAATTTTATAATAACGTGAGTAGTTTCATTTGAAGCTTTCTCGCCAAAGT
AATTTCCTCCTTTGTTGAATAGGTCAGTATTTTAAAACCCGTGTAGGTGGCTCTTCATAA
AACTTCCACAGCTACTGGTCTGCAGCCGCTCTTATGGTAGCAGTTGTGGCATTCCTCTGT
GGGAAAGGAAACTGTCACACAATTAAATACCTCTTTCTTAGCACGACAGAAAGTGGGCAT
GTGAGTGACAAACAGATGACTTCTGTGGTTTCGTTGGGCTGAGGAGATGACCCACCGGAA
AACAGATGACGATTTTAAAAATGTCTTCGACTAAAATGAAGAAAACGTAATTGAGTGTCT
GAGTAATGCTGTTTGTGCTCTTTTTAGAACCTGCGCTTGTTGCCAAGTCTTCCATCTTAC
TAGATGTGAAACCTTGGGACGATGAGACAGATATGGCAAAACTAGAGGAGTGCGTCCGAA
GCATTCAAGCAGACGGCTTGGTTTGGGGCTCTTGTGAGTTCAGTCTTTACTTTCTGAAAA
TAGCATCTGGAGTTTGCATAATTACCACCTTTGTCAAAGAACAGGCCTTTTCTGAGGTTT
TTTTCTTGATGCTCTTTCAGCTAAACTAGTTCCAGTGGGGTATGGAATCAAAAAACTTCA
AATACAGTGTGTAGTGGAAGATGATAAAGTTGGAACAGATATGCTGGAGGAGCGGATCAC
TGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTTAATAAGATCTAACGTTC
GTTGTAGATAATTTCCCTTAAATAAAAGCTTGAAGACAACTGTTGACTCTGACTCTTACA
TGGGGTGGTTTTTATATTTTTCCCATTTTGAGGGAAGAAACTCAATGGATGTGTAATTCA
AAAATATAAATTTGGGTCAGCATTGTTAGATATTTAGCCCAAATTAGTAGAAATGGACTC
GATCGTAGTATAGTTTCTGGACCCAATGCACGAGGATACCACTTTGACCACAATATTGCA
AGTTTCATATTTGCCTTGTTTTCAAAAGAAACTCTATAAACTTCACTTGTGGAAATTTTG
GATTAAGAAATTTGACGAGGGGGGCGCCTGGGTGGCATAGTCGGTTAAGCGTCCGACTTC
AGCCAGGTCACGATCTCACGGTCCGGGAGTTCGAGCCCCGCGTCGGGCTCTGGGCTGATG
GCTCAGAGCCTGGATCCTGTTTCGGATTCTGTGTCTCCCTCCCTCTCTGCCCCTCCCCCG
TTCGTGCTCTGTCTCTCTCTGTCCCAAAAATAAATAAACGTTGAAAAAAAGAATTAAAAA
AAAAAAAAAAAGAAATTTGACGAGGGGTGCCTGGGTGGCTTAGTTGGTAGAGCGCCGAAC
TCTTGATTTCAGCTCAGGTTGTGATCCCAGGGTTGTGCGTTGGAGCTCCATGTTGGGCTC
TGCCCTGAGCATGAAGCCTGCTTAAGATTCTGTCTGGGTGGCTCAGTTGGTTAAGTGTCT
TCACTTCAACTCAGGTCGTGATCTCATGGTTACTGAGCCCCAATAGGGTTCTCTGCTCTC
AGCATAGAGCCTGCTTTGAATCCTCTGTCTACCTCTCTCTCTGCGCCCCCCACCCCATGC
TCTCTCAAAAATAAACGTTTAAAAAAGATTTTCTGCCCATTTGCCCTGCTTGTGCATGTG
TGCAGGCACTTCCTAAAGCTAAAAAAAAGATAAATTTTCTACTAGATTTTTAGCCCTGCA
GGTTTATAATGGTTCAGACCTTGGGTACTTTTGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 1529..1651, 2293..2419, 2675..2741, 3147..3272, 3380..3534
1001..1080, 1529..1651, 2293..2419, 2675..2741, 3147..3272, 3380..3531
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved