Felis_catus Locus SLC25A3
snOPY snoRNA Orthological Gene Database
Felis_catus SLC25A3
Felis_catus
SLC25A3
scaffold_2208
SNORA53
5763..6013
8059
ATGGTTTTCTAAATTTATTGAACAAATCTTCTGCCAATCACTTTCAATCTGGTTTATCA
AGTAGTGTTAAAATGCATTTATTGAATGTTTTAATATGTCATATAAACTATTGTGATGAA
CCCCCAAGCTGTCTTGTCTAAAGAGTTCTTGTTGCACATTTTCTTTTGAAATACTTTCCT
GTGGTCTATTGGAAAATGCAGACATGTCTATGTGTAATGTCAATGTATGGAACTTAAAAA
AAAAGTACCTTAATGGCAGACGTTGTTAACACAAAATACTGCAGTAACATTCTAACTGCA
ACACCGAAATAATGTATCATCCATCATTCAGGGTTTTTTTTTCTGTTTGTTTAAATGACT
ACCACCCTGGGACTCATCTAAATGTAAAAGTCTGGAATTCCTGCGTCAAAGAAAGACTCT
TGAAGGTGAAGGCAGACAAAAACAGGAGGTCACCGAGCACTACCGCACACCACTCAAAAA
CCCGGCCCCGGAATGTGCGCCTGCGCAGAACGAATCCTCCGGCGCAGAAGCCGGGCCGGA
AGTGCCGGGGCAGGCGGGGGCGGGGATACGGTTGCTAGGTGAACGTGATGACGCCACGGC
ACCGGCACTCTTCTCCGCCAATGGGTGCCCCAGCTGTAGTGACGCGTAACGTGCGTCACG
CTGACGAAGCGCGAAGGGCACAGATCTAAGGGCCAGGAGGACGTTCGGCCTCTGTGAGCC
GCAGCCTTGCCGAAGGAGCGGTTGTGTGTTCGCCATCTTAGGAAGTGAGTGTGCCGGGTC
TTCCCCCCAGTGGGTGCGGGGAATGGAATCCCTGTGGGGAGCTGCTTGGACTGCAGGCCT
GGTCGACCTCCTCCCTTGTGGAGGCCGCCATGACCTCCTCAAGGGCGCGGAGGCGGGCAG
AAGGAAGGCCCGTGTCGGGGTCCTAGGGTGCCGGTGACTTTGGCGGTCTGACGGGTCTCT
TTGCCTTTCTTCTGACCGCTGCTCCCTGTTCCCTTAGGAAGATGTTCTCGTCTGTGGCGC
ATCTGGCGCGGGCAAACCCCTTCAACGCGCCCCACCTGCAGCTGGTACACGATGGCCTCG
CGGGCCCCCGCAGCAGCCCCGCGGGGCCTCCGGGTCCGCCCCGCCGCTCCCGCAATCTGG
CAGCAGCCGCTGTGGAAGGTGAGTTTAGACCCTAGCCCGATTCGGTCGTTATGTTCGTCG
TGGCTCATTCGGCTTTAGTGGCCTAGAGGACGGAGAAGGACACACTTGGTGTTCTGCACC
ACAGGACGGCGCCCACTTGCTTGCCCTAGGATGTCAGCCCTTTCCGCCCTAGGCCGTGTG
TCGGATCCTTGGCCCTCTCTCAAGGGCGTGGAACGGCCTAGGCACAGTTCCTCTGTGACC
TCCACGTCCTCGAGAAAGTAAAGCTATAGAGGCCGTCACTAGCGTCTTATCTTCTCCTCA
GTAACCTGCCTGGTCAGCGGGCTAAGTATTGGGTGAACTCTCCTTCGTAGCTGCAGGCCA
CCTGCAGTTCTTTCTAATTGTATTGTCTGTTACTTGATTTGACTTTGGTTATTAAAAATA
CTCCTTCCTCTCATAAGTATTCCCAAAGTCTAATATTCCTTGACCCAAGGTGTAAGAGAT
AATTGGGTCTCTTGTTTTAATGTAATTGGTAGAGGAGGTGACAGCAGCCCCAGATAGGCT
ATTAAAAGGCCATAGTAATTGGTAGGGATCCCTTTAGTCTTATCTCTCCGGATTCTTTTT
GGTTAGACTCAACTTTAGCTTAATTGTGTTTTGAATCCCAGCGGAGTGTAATGTACAGAG
AAATCCAAACACCAAATTATAGGAGTCCTGTAGATGTTATCTATATCGTGTGCCTGTAAA
ATCTAAACTTTTTAAATCCTTTATGTGTTTTGTTATGTCTTTAGTGTGGATAAGAAAGTC
CTTATACTGTTGTGTAGTAGTAAATGTATTTGACTGCAGGAATTTGTTTCGTTTTATACT
TATATGAATCCATAGGTGGAGATAGTATTGGTTAGTGGCTGGGGTATACTGAGAAGTTTG
CAAGCTTTTTACTTGTCCAGTGCTCTGAGTTTGTACTCTGAAGTGTGTTTTTATTAGCAC
TTAATAACTTGAAGTTTAATTTTAATTGGAAGAGCTATTAATGTTGTAGGAAACATTTAG
TATGGCAAAATAGGTAATAGGTAATGTCTCATAGTACCTTCATAATCTAAATGATTCTTT
GATTTTGGTAGTAAATGTCTTGTTAAACTAGGTGGAAAATTATCTTTCAACTTAATTGTA
AACAGTGGCCAAAGTTGTTCAGTTGTGATAGCATTATCTCCCAGGGAATCTTAGTTCTCT
TTCATTCCCATGGCCTTAGTCATCTCTGAAGAAATATTTACCTGATTTTTTTTTCAACCA
AACAGAGCAGTATAGCTGTGACTATGGATCTGGCAGATTCTTTATCCTTTGTGGACTTGG
AGGAATTATTAGCTGTGGCACAACACATACAGCATTGGTTCCTCTAGATCTGGTTAAATG
CAGAATGCAGGTTTGTTTTGCATGCTGGACTAAAAGTGTATTTTTGAAGCATGGCTTTTA
AGTTGTAAAACATAAGCATCTAACAAGCTGCGTGGAAACCTAACTGTCCAGGAGGTAAGT
TGATAACCAGTAACATGAGATTTATATTGAAATGCATGGTGTGTCTTGTCTTACTACAGA
GTACAGTTGCGAATATGGCTCCATGAAGTTTTATGCACTGTGTGGCTTTGGTGGGGTCTT
AAGTTGTGGTCTGACACACACTGCTGTCGTTCCTCTGGATTTAGTGAAATGCCGTATGCA
GGTTTGTATTGAGACGGCAACATTGAATGTATCTTCCATGTGTGATTTAATTGCAAATAC
TTTTAAAGAGCTTCACAAATTTGAAGACATTACAACTGCTAGAAACTTCAGGAAACCAAA
CCCAAATTTTCTTAACTCGTGATCTTTATTTTAATTGGTTTTGTTTGTTTTGTTTTGTCT
ATTTTTTGAGAGAGACAGAGACTGCTTGAGTAGAGGGTGGGGGGCAGAGGAGGGAGAGAG
AATCCCAAGCAGGCTCCACACTGCCAGCACAGAAACCGATGTGAGGCTTGAACCCGTGAA
ACTATGAGATCATGACCTGAACCAAAACCAAGAGTCAGACACTTAACTGACTGAGCCACC
CAGGTGTGCCTCAAGATTTTATTTTTAAGTAACCTCCAACATGAGGCTCAAACTTAACCC
TGCAATGAAGAGTTAGTTGCATGCTCCATAGGCTAAGCCAGCCAGATGCCCTGGAATGCC
TCTCTTTGAAAAATAAAATTGTAGGCAGATTTTTGGATCCCAAACCCTGGCTATAAATGT
TTTTTTTTTTTTTTTTTTTGCTGCTGGACTGTTTTGACTAGAGTTCCTCTTCAAGGCCTG
CTGGTTCTTTATGCTCCCAAATTGTCATTTTATAAGCAGTTACATGACAGAGTGGGTAAT
CATTTGTGTATTTTTGAAGTAACTTCATGTCCCTGTTTACTGATAAGATCAGGGCAGAAC
ATTATGTACATTTAAAAAATACTCATTATTTTAGTGTTAAAATTATGTAGGCATAGCTTC
TTGTATGTTTACATAAAAGTTTTTTGCAATTAGAATATTTTAAATTAGGATTATTGAAAA
AAAATAATCAAACGTCAAAAATTTATTTGCCCCAAACAGGATTAGAAGTCCACCTTACCC
TAAAAGAGAGAGGAAGGTGAAGTAAAGGAAAAGTGAAATAAATGTTAGCAAGGCAGGAAG
GTGATGTATACCAGCCATTTTAGTTCTGGCAGATATAGTGAAATAAGATTTTTTTTTTCT
TTTCCCAATAGTTAATAGAATGGATATGAAATACACCTTTGCTGAAACTTAACGCACGTC
TCTTGAAGTGAATTTAATTTCTTAAGTCAAAAGATAAATTCTCATTATGTCCATGTACCT
TCTCAGCTTGTATTTTTTTTTTAATTTTTTTTTTTAACGTTTATTTATTTTTGAGACAGA
GAGAGACAGAGCATGAACAGGGGAGGGGCAGAGAGAGAGGGAGACACAGAATCGGAAGCA
GGCTCCAGGCTCTGAGCCATCAACCCAGAGCCCGACGCGGGGCTCAAACTCACGGACCGC
GAGATCGTGACCTGAGCTGAAGTCGGACACTTAACCGACTGAGCCACCCAGGCGCCCCTC
AGCTTGTATTTTTTAAATTTGTCTTAACTTCATAAAACTTCGTAGTATATAAACTGCTTA
ACAGGCTAACATACATTAGGGATATAGACTTATTACCTAGGCAGTAGCTTTAAAACTAAA
TTTTTTAAAGTGGTAGAGTTGGATGGTGAAAAATCTGAGTCAGTTTTATGTATTTTTCTA
GGAATTTTACCATCTTAAGTAATCCTCCAAATTAATTCTGACTGAAAGACCTTAATGTAT
AAAGTTACATTTACAAAGATAATTCTAGATATTCAGTTGATACCATGCAGTGAACTTGTA
TTTATCTATCTTTTGTGTAGTTACTGAAGTTTATTATAGAACCAAAAGGAAAGACTAATA
GCAAAATTTAATATTTATGAGAAGTGATAGCTCTTTGGTTAAATTAATTTTTTTCTTCTT
GTTTTAAATAAAGGTGGACCCCCAAAAGTACAAGGGCATATTTAATGGATTCTCAGTTAC
ACTGAAAGAGGATGGTGTTCGTGGTTTGGCTAAAGGATGGGCTCCGACTTTCATTGGCTA
CTCTATGCAGGGGCTCTGCAAGTTTGGCTTTTATGAAGTTTTCAAAGTCTTGTATAGCAA
CATGCTTGGAGAGGTATGTAATTTAACTTTGAAATTGAAGTCCTAAGCTTTAACTTAAAG
TTTAAGACCAAAAAGGATTTTTTTTTTTTTTTTGTCTTGCTCACCTTATTTTAGAACTGA
AGAAATGGTCTCAAAAAGGGTAAGCAACATGCTTTAAATCAGGAGAGACCGAATGAGAAA
AAATACATTTTTTAAAATTTCAGTGCTGTTTTTATTCTACTGTGCTCATTCCCAAGTAAG
TTGGATTTTGAGTTTTTTAAAGAGGTCTCGGATTCCTTGTGTAGTTCAAGGGCCAACTAG
ATGTTGGCACCTAGATGTTCAAAGAATAATTCACATTGTACTATGGTTGATAAGGTTATG
AGAGATTATAAACTTTCAGTCTCATCCTGAAATGTAACTATTTCCTTTAATTGTCCCTTA
ATTGAAAACAGCCAATGCAGCAGCAGTACATGTTCCTTCTTACGCTTTTCAATTAGGAGA
ATGCCTATCTCTGGCGCACATCACTGTATTTGGCTGCCTCTGCCAGTGCTGAATTCTTTG
CTGACATTGCCCTGGCTCCTATGGAAGCTGCTAAGGTTCGAATTCAAACCCAACCAGGTT
ATGCCAACACTTTGAGGGATGCAGCTCCCAAAATGTATAAAGAAGAAGGTTTAAAAGCGT
AAGTAAACATTTGTCTAAAGTTATAGTGTAAGAAGGGAAGTGCTTTTGTTAGCAGTAAAC
CTACCAAACTTTTTTTTTTTAACTATTATGTTATTTAATGTCTGTTTCTCCCTTAAGTAG
AACCTAACAGGCAAGGACAAGTTGATACATAGCATGAGCCCTGAATTACAGGTTTTTCTT
AAGAAAGAACTGGTCAGTCTGCAGATAACTCGATACTTGACATTAACTGTTAACTTCTGG
GAAGAGCTTGTTAGAATTGTCATCTGTGTTTACCAGCTAAGAATTGGTATATAGTCTGGC
CACAACATGCTTCCTTAGATCCACCTTTGTGGATGCTAATCTTGAACTGAGTTCTACTTG
TAAACTTTCTGTTTCTTGTAGTTCCAGTCAGAGAAACATCCAGCAACTTCTTCGGTTGTA
TAGTCAAAGGTGCTTGAGTCATTGGCATGTGAGATAAATATACCTGCATGTTAGTCCTAG
GTTCTGATAGAAATGACATGCAATTGTGCTGCCATTTTTTTTTGCTATCAGGACTTGACT
GGTGTGCGGACACTTCTGTTAATAATGAAAATCTCTGCTAGGTGAATAAAGACAGCTGAG
TAAAATAAGTCTCCTGATTTCCTAGATTCTACAAGGGAGTTGCTCCTCTCTGGATGAGAC
AGATACCATACACCATGATGAAATTTGCGTGCTTTGAACGTACTGTTGAAGCATTGTACA
AGTTTGTGGTTCCCAAGCCCCGAAGTGAATGTTCAAAGCCAGAGCAACTGGTTGTAACAT
TTGTGGCAGGTTACATAGGTATGAATTATTTAGAGCATGTTTATGAAATTAAGAACAAAT
AATCATTTCCATTATTGGCCTCTTTTTGTGAGGAAAAAAGTATTCCAAAGAAGTCTTCGC
ATAGCATTTTATATGCCTTCTAGGATTCATAAATGCTTGTTAGCTTCTGAAAGAATTGTT
TTCTCGTTTGCATGTCTTAAGTTTTGGCATGTATTGATTTCACTCCCTCATCATTTGGGT
TTTTGGTTTGTTTTTCAAGAATACTTTTTTTTTTTTTAAATATTGAGAGAGAGTGTGAGC
GGGGGAGGGGCAGAGAGAGAGAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAAATGATCCCCAGGCGGGATTATTTATCTGACTTTTTTCAGCTGGAGTCTTTGG
GCAATTGTTTCTCACCTTGCTGATTCTGTGTATCTGTGTGAATAAAGAGAAAGGTAGCAG
TGCTTCTCAAGTCCTCCAGAGACTGGATTTCAAAGGTAGGATTCTTTTTTGCTCCTCTAA
ACCAAGAGTAACACTTAGGTATATTTCATTTCTCATTTCATGTGTTATGTTTCAACCAGG
TGTATGGAAGGGACTCTTTGCCCGTATCATCATGATTGGCACTCTGACTGCGCTACAGTG
GTTCATCTATGACTCTGTGAAGGTCTACTTCAGGCTCCCTCGCCCTCCTCCACCTGAGAT
GCCAGAGTCTCTGAAGAAGAAGCTCGGGTTAACTCAGTAGATTGATCAAAGCAAATGTGG
ACTGGATCTGCTTGTTGATCAGTGTTGAGGAAAGTGCAAGAGAAACTTTTATATATTTGA
CAGTGTAGGAAATTGTCTATTCCTGATAGAATTACTGTAGTACTCTTGCCTAAGGCGAGA
GTTTCAAACTTACTGTTGAAATAAACCCAGCTGTTCATGATTTGTCTGTGACTTGATGGT
TATTTTGAAAACTAGTTTCTAAAGATTTAATGCTAAAATGGAAAGGATTAAGTGTTAAAA
CCTCAAGGAAAAAAATGCAAATTAACCACTGTTGGTTTAGTACTCTGATCCCTACTCATA
AATTGTCGTGTGTTTCAAGTTTTGTCAAACAAGAGAGTTCCTATATTTTTAAGAAACATA
CCTGAATTTTCAAAAAACTTGATTTAGTTGTAGTTAAATTGAAATATGGATAAATATTTG
TGGTTATATTTTGAGAAGTAAATTTCAGCATATAATCAGATTTTTGCAACACGTACTATA
CTTTAAAAACTCCTAATGAGTTTGCTAATATCATTTGTTTTTATTTTATTATTTATTTAT
CTTATTTGGGGGAGAGTGCAAGTGAGCAAGGAAAGAGAGGGAGAGAGAATTTTAAGCAGG
CTCTAAGCTCAGCCCCTGAGTCTGTCACAGGGCTCTCAGTCTCATGACTGAGATCATGAT
CTGAGCCAAAATCAAGAGTTAGGAAGCTTAACTGTTGAGCCACCCAGGCTCCCCAACTAA
TCCTCATTTGTAAATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1157, 2405..2529, 4633..4812, 5276..5457, 6085..6257, 6707..6717, 6720..6749, 6752..6757, 6760..6814, 6899..7059
1001..1157, 2405..2529, 4633..4812, 5276..5457, 6085..6257, 6707..6717, 6720..6749, 6752..6757, 6760..6814, 6899..7056
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved