Felis_catus Locus RPS13
snOPY snoRNA Orthological Gene Database
Felis_catus RPS13
Felis_catus
RPS13
scaffold_134100
SNORD14, SNORD14
2074..2162, 3409..3495
4345
TCTCTCTGCTCTTCCCCCCCACACTCTCTCTCAAAATAAATAAACTTTAAAAAGTGATA
GCGGTGGCTGCGTGGTAACTACCATGACTTCCAGTGTAGCACTTACTACCAGGGTATTGT
AATTGTGAATTCATTAAGGGCAGAGAAAGACTGACGTAGCTAGTACCAAGACAAGAGCTG
CCCTGGTGAATGGATGAACAACTGCATGGTTGAACCTCAGGCGCCCAAATTCGGTGGCCT
TTCTGGGGCAGGGACCAAATCCACCAATCCCTGAAACTGTAGCTGTTCCACGCTCACTCC
CAGTCGGGGATTCGAACCTGTACATTTTTAGCGCTGACAGCTCTTCCAGAAAGTCTAACG
GCGCACTTAATTTCCCGCTCTGGCCAGAAGCCTCCTTAAAGACCGATGCATGCCGGGATA
CGTAGTCCTGCACCTCGAGGAATCTTGGGGCACAACTCTGAAAAGCATCTCGGGACATGC
AGCCAGGGGACGCCGGGAGTCACGCAGCGTAGCTCCGCCTCCTGCACGCGAAAAGGGTGG
GCGTATGTGAGGTCACTTCCTGTGTGCTGGGTAGCTTCCTGCGGCTTTCCTACCCTCGCT
CTCTTTTTTGCTGCCTGACCGCCGCCATCATGGGTCGCATGCACGCTCCCGGGTGAGCTC
GGGTTTCTGAGCGGGTTGCAAAGCTCGGGCCGCGGGGTGAGGGGAAAAGGGGGGCGTGTG
GGCAGCGAATTGAGGGGGTTGATGTTGTAGTTTATTGTGGCACTGGCCACCACCACCACC
ACCACGTTATTCCGAGACTTTCTTTCCCCAGGAAGGGCCTGTCCCAGTCGGCTCTGCCTT
ACCGCCGCAGCGTGCCCACCGTAAGTAGCTTGCGGAGACACGGGAGAAGTCGGGGAGGGG
TGCTACTATCCGTCGCTCGGGAGAAGCGGTACCGAGGCGTGGGGGCCATGTGTGCGTGAG
GAGCTCCTCTTGGAGGGTGGTAAAGACCTCTGTGCTTCGGTACCATCCCTGGTTTCTCCT
TCTAAGGCAAGTTTCTTTTCCCTAAACAGTGGCTGAAGTTGACGTCCGACGACGTGAAGG
AGCAGATCTACAAACTGGCCAAAAAGGGCCTGACTCCCTCACAAATCGGTGGGTATATAT
ATATAATGTAGCTCCTTCCGCCTGCCTTCGTGTAACTTGCTGAAAAAGTCGCTGGGGGTA
AACGTGTCGCATACGTGCTTTAAAAACTTTTTGCTGGTTTTCCTGGCTTTACCGCTGATG
ACCGCGGCCAAGTGTTTGTTTTTTGAACTCTCAAGTTCTTAATTTGGAAGACGGGAAAAT
TGTTAAAATGCTCGCCAAAATTTAATGAGTACTTAGTATGCGCTAGGTAGTTAGTTATTC
CTGGCTGAATGGTTCTATACATTTTATATATAATGACTTCATGTAATTCTGATTGCCGTA
CTTTCAAATGATTGTGAAGTTTTCTCCATCTTACAGTTGAGGAAACTGAGGCACCGTGCA
ACTATATAATTAGTCTAGCCAGAGGTATCACACAAAAATAGGAAATACATAATAAACTGT
AAAATACTCAGATGGTGCTATTTTGAGATTTAATAATGTATGTAAAGTTCTCAGAAGAAT
GTCTGATTATTAAGTTCAGTTATTAAGCAAATATACGTGGGAATCTCACTGATTTCTTTG
GTGGCCCTATAATCCATCAAGTTCACTCTGTTGATAAGCACCAGCATTGGCAGTTTCCTC
CAGAACGGTTTTCCTTAGTGCTGGGTAAACCAACCTTGGATGTCTGAGTGAGCTTTACAT
GCATTCTCATGTTGTTTTTCTGTGATACAAAAGGAACCCTGTTTCACAGAGGAAACCGTG
GATAATGACTTGATCTCAGAGCCTTGACATCACATGCTTAAGTTCTGTGTTTGGCAGGGG
GGATTTATATTACTGTTTTTTTCAGGTGTGATCCTGAGAGACTCCCATGGTGTTGCACAA
GTACGTTTTGTGACAGGCAATAAAATTTTGAGAATTCTTAAGTCCAAAGGACTTGCGCCT
GATCTTCCTGAGGACCTCTACCATTTGATTAAGAAAGCTGTTGCTGTTCGAAAGCATCTT
GAGAGGAACAGAAAAGTAAGAGAATGGAACTGTTTGTATGAGCTTCAATAAACTGTAGTG
CATCTGATTTGAATTTCCTAAAGAGGCTTGAAACACAAACTGTGACACCACAGTTGTTTT
GAAATAAAAATTCTACCAGAAAAGACTGGCAGGAGGTGGGTGGCTTTGGCTCCTCTAGAT
GCAGTATATCACTTGATTGAAAATGTTGAGTTATTTATTTGCAGAATTTTGTTTTATTTG
CACAGTTTTGCGAATCATTCATGTTAAAATTTGGGGGCGCCTTAAATTCCCTTAAGGATT
TAATCTAGCCACATGAACCTTAGCCTCGGATTCTATTACAGGGCATTGGGTAACTTAAAA
GTGCATGGTATCTATACATTTTTTTGTTAAAATAATATTTGATTATTGTTTTGAGGGAGT
TTTCTTAAATTATGTCGATTTTTATTTTTAGGATAAGAATAAATCTTTATAATTTGTCCT
TTAGGATAAGGATGCTAAATTCCGACTGATTCTTATCGAGAGCCGTATTCACCGGTTGGC
TCGATATTATAAGACCAAACGAGTCCTCCCCCCAAATTGGAAATAGTAAGTATTAACCTT
TTTTGTTAATAAGAACAGACATTAGCCATATAGTAAACACAGTAGCAACTATAGTAAAAG
GCCTGTTAGTGAATGTTTTAGGCCATGGCTATGTGGTCAACTACTATTTCAATTCTGCCA
TTTTGGGAGGAATACAGCATAGACAATATGTAAACAAATGGGTATGGCCGTGTTCCACTG
AAACTTTATTTACAAAGGCTAGCAAAGGGCCATAGTTTGCAGACCCCTGATTTAAAACAT
GAATAAGCCCTTTGAATCACTTCTAGATAGTGGGTAAAGTTTCAGCTCATAGCTCTGCTC
CTTGTTTTTATGTTGTCTTCATTTTTGCATAGATAGCTCATTATGATGATTAATTTCTAA
ACATTCACAGGTTTCACTAGAAGGGTTTTTCCTTATGTTGGCCGGTTCTCCCTTAGATGA
GTGAGCATCTTTGTTCCTCATGCTTAAACACAATAAACTAATTCAGGAACCTTGGCGTTT
TGGTGCATTTTATGTATTTGTGGTTTATTTTAGCTGTTTGAAAATAGCTCTGCTAGGTGT
TAGAGTCTGTGAATAAATATGGGGGACCTATAATAATCCAACTCTTCTTCCCTCTCCTTT
TTTCCTTTTCAGCGAGTCATCCACAGCCTCTGCCCTGGTTGCATAAATTTGACCATGTGC
TCAAGCAATAAAATCATTGTCTAACAAGAAGCATAGTTTGTGTTTCTTTCCCTAGAAGTA
TATATATCGTCGATTCATATGTATTGGTTTTTTGATGTGGAAGTGTTGTAGCACAATGAG
AAGTGTGATTTTGCGGGGAGCAACGAGATAGCACCCATCTATTCATCCCTTCACTGCTCA
ACTATCTGAGCAGTTTATAACTTGGTGGGTGGTTAAATGGGGAAGGGAGTGGCAGAACTG
GAAGAAACTAGGAAAGCAGTGACTTGTTTTGATGTCATGGTAAAAATGTTTCTAAGTATT
TTTGGTACATTTGATGTTAAGACTGAGGTAGACCTGTGAGGAATTGTTATCCTGGTAGTG
TATGTGGCAGTCTACTAACAAATGCACGAGAAAGTTTCTCTGCAGGAGGAACATCTTTAG
TATGAAGGGTCCTAAGGAAGACCTGATAATTTGATCCCAGTCTTGTTGGTAAGGCTTAAA
GGTGAAGAAAGGATTCAGGTAACAGTAAGCACAGTTCATCTGAATCAGGGAGCCAGAAGA
ACTGTTGGTGAGATGAACCCAGGTCACTAAGCCTTGCAACTTTTGGAGGGTTAAATAAAC
ACTCAGCTGGGTGTTTTCAGAGTATTTAATTCTTTTTTTTTTTTTTAACTTTTTTTTTTT
TTCCAACGTTTATTTATTTTTGGGACAGAGAGAGACAGAGCATGAACGGGGGAGGGGCAG
AGAGAGAGGGAGACACAGAATCAGAAACAGGCTCCAGGCTCTGAGCCATCAGCCCAGAGC
CCAACATGGGGCTCGAACTCACGGACCGCGAGATCGTGACCTGGCTGAAGTCGGACGCTT
AACCGACTGCGCCACCCAGGCACCCCTCAGAGTATTTAATTCTTAACCTAAGAGGTATGT
GGGTATCCCTGTTTAAAAGAGGCGAGTCTGGAACCATAAGGTAAATGATAAGCTGTACGT
CGGGCTGGTATATGGAGCCACGCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1183..1231, 1421..1499, 2317..2486, 2956..3056, 3684..3717
1001..1023, 1183..1231, 1421..1499, 2317..2486, 2956..3056, 3684..3714
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved