Felis_catus Locus POGK
snOPY snoRNA Orthological Gene Database
Felis_catus POGK
Felis_catus
POGK
scaffold_557
SNORA52
2081..2211
11960
CCCACCTCCAGCCCAGGAGAGGACGGGGGAGGCGGCGGCAAGTTTGGGCCCCTGCTCCA
GGGATCTGAAGCCTTTTCCGCCCGCCCCTGACCTAGCCTTGCCGTGTTCGCCCGTCCCTT
TTGGCAATACCGAAGAAGCACGCTGAACTCCGGAAGGATCGTTTCTTCCGAAGCCCGGGA
GGATGCGGCCCACAAGATGCACACTCACTCCACACCTAGGAGTTGCCCGCGCCCCTAGAG
GGCAGGAGCGCGGCCCTTTGTATTGGCCTACAGCTGGACCCGAGAGAATATTCTTTTCGC
CACGGAGGCATTTCCCGGTGGGGGTGGGCCCTGACAGATTTCTGCACCTTCTCGGGTATC
CAGGCATACACCTCGCTGTGTGTCAATGAATCTACGGATTTGGAAAATCTCCTAAGGCAG
AATGACTATTTTCTGAACCAAGCTCATGGACAAAATCATTAACTATGGAGAATCCAGGTG
ATGGGTGTTCTGGGCCAGCCAACTTCCAGGTGCTTAACTGGCCTGTAGGGAGAACCCCGT
TGAGCAAGTGTCCGGGCTGTGTTCGGACATCTTCATTGGTAAAGAAGCTAACACCCCTCT
CCTGTTGCTTATTTCATGTTCAGGTGGCACTGGCTGTGAGAAAGTTCTGCCTTTCAAAGC
ACTCTTAAAGCACTCTCCCAGGAATGTTTACCCACGAGCCCGTTCTGCCCCTGGGTCTCT
ACAGAACCAGTCTGGTCTCTTCCACAGGTAGCCTCTTTAATATATGAAGGCAGTCAGGTA
TACTATCTGCCTGCAGCCCCTCTTAACATAATTAATATGCCACCTTCCAGCTTCCTGGTG
CTTTTCCTAAAGCCCTTCCTCCCCAGGCCTGACTCTTCCTTCCCTTATTCCAGCCTGAAC
AGTGCTTGGGGATAAGAGGTTTGCACAGGCACCCCCCATCCCAGGCTTCGGAGAGTTCAC
ACTAGTGCCTGATTTTTCTCAACCGAATCTTGCTTGCAGAGATGGATTCCACAGCCTACA
CTCTCAACTTGACCCTGAAAGAAGAAGAAGAGGAAGAAGAGATTCAGAGTCGGGAACTGG
AGGATGGCCCCACCGATATGCAGAAAGTCCGGATCTGCTCAGAAGGTGGTTGGGTAAGTA
GGAAGATGGGTCCACACAGCTGTGAGGAGAGGTCTGGGAGCCAGGCTTGTTTTAAGTCTC
CTCCTCAGTCAAGCATAGGAAGTAAAAATAGCCCAGCCCAGCCCGGTATGTTTGCATTCC
TGAGAAAACAGTCCTGTGGCTTTAAAAGGCACTGAAGAATGGAGCTGGTTATGGGAACAG
TCTCTTCAGCCATGTGGCTTATCGTCGTTCGGACTGGAAATCTGAGAGGCTTGCCTCTCT
CCTGTGCCCCTGAATCCCCTACGTTTTACTTAGTGCCAGGCACGTTGCAGACACCAGCTA
AATGTTTGCTGACCTCTGTTAAAGAAAAAATTACTCTGACGCTTGTGACGACGGTAAGGA
AGATTGGTCGGGACTGTTGAGATGGGTGTCAGGACTCCTGCAGTGGGAGAGAGCTGGGGC
TCAACGCTGAATACAGTGAGACAAGCAGGGATTTCCAGCCAGGGATCCAGAGTGGGTGAC
AAGTTACTGAGACGGGACACCAAGAATAGGGGGATTCTTGCTAAAGGCAGACTAGGGTGA
TCAGCTGTCAAAGGTGGGGGAATCTTTCTAAGGTAAAGTAAAAGGTTTCTTGCTAAAACT
GGGCCAGGCAGGCTGAGGACAGGAGGGGAGCCCCCATGGAGGCCTGGTAGGGAAGAGGGC
CCAGAGGAACGTCACTGAAGTTTGGGAAGGAGAGAGTCTTTTACACCCACTGCTGGCTGA
AGGGAACCTTTTTAAATAAGACTTGGGGCGTTGAGCTGACAGGAGGAGAGCTTCAGTCGG
TTCTGTGTGAGGCCGTCTTGTGATAGCACACCCAGGAGAGCAGCATTATCAGCCTGCCCG
AATCGAGGGATTGGGGTGGTAGGCAGCAGAGAATATGGAACATATCCAAACAGAAGCGTG
TGATAGAATTAGAGTCAATTCATAAAAATATAAATGCAGCGTGGCCCATCCTAATCCCCG
CCAGTCTGCCTGGGGCCTGCCAGGTTTTGCTCGTGCACCAGAGAGCTGTAGAAGCCTCCC
CCAGAAAAGTGAACAGACAGCGTGCCTGTGCCCGGGGCACTTCTGGATACCCCGGGGGTG
GGGGGGGGGGAGTGATGTAAGTGCAAGAGATATTTATCCTTATAATCGTGTATAATTATT
CACAGTACATCCCGGACATCATGACATTTAGGCATGAATGGTAAAAACTTTAAATATGCA
ACAAGTTGCATTCCTTTTCTCCGGCGAGTCCTGTGTATGAACATTATCAGTATCCATTCT
ATTCCTTTGTTTCCAGTAGGAGATTGGTATTCATAGAAACATGGCTCTCCCAAATGTCCG
GTCCAGCTCCCCTCCCGCACAAGAGAACTGGGGAGCAGAGAGGTTATCTACTTTGCCCCA
AAGTTACACATGTACGCTGACATGTGTTCTTAAAAAAATAAATGTCTCTCAAGCTGGACC
CTTAAAAGCAGTGCATTTTATTGTATGTGTGTCATACCTCGATGAAACACAGTGCACCAC
CAGGCTCTGGGTTTTCAGTCGGGCTCTGTAGGCTGCACTGCCATTTTCTGTTTGTGTTCT
CTGCTCACCCCCACCCCTCTCTAGTTCCGATCCCCGCAGCTGGGGAGACCTTCGAGGACA
GGAGTCAGTCCCATTTAGCCTGCAGCAAGACCTCAAGGCAGTAGAAACCCTGGGCTTTAA
GGCTAAATTGGCCAACCCAGAACCTCTAGATAGCATGGAGAACCTTGGAAAGTGGGTGCA
GTAAAGGTGGACGTTTAAGTGTTGTCGGAACAGTGAGAAGGGAGCAAGGCGAAGGCCATT
CTTAGCTGGGAAGGAAGGAGGTCACTGGAAGAGAGGGACTGGTTTTTGTGGCCTCCAGGC
AGTCTGCCCCCTGTCCGCGGTTATTGAGCACAGTGGTGGTGTTAAGACAAGATCCCTGGT
CTCCTGGAGTTGCCAGTCTCGCAAGGAAGGTGGGGAAGAGAACATAATTCATAGTACAGT
ATTCAGAGTGCAGTGGGTGAAGTCAGCTCAAGAGCAGGGTCTCATTCAGCTGGAGAACTC
AAGAGGCTTTGTTCAGGGGGCAAGCATGGACCTGGTCTTAAGCAGTGGGCAGGTTGGCTC
CCAGGCCCATTTCCCTCCTGGGGACATTTGGCAATATCTGGAGACGTTTTTGGCTCTTGC
GATTTGGGTGGGGGTTGGGGAATGGGAGATCCTACTAGGCATCTCGTGGGGAGAGGCCAC
GGACACTGCTAAACATCTCCAATGCACAGGACAGCCCTCATGACAAAGAATTATCTGGCC
CAAAATGTCCGTGGTGCTGATGTTGAAAAACCCTGTTCTAGGGCATTGAACTAGGGAAAG
AAAAGAGGTGAATCTGTTCCTTAAATATGTATTTTGGTTGTAGAGAATTGTGTTAGGGTG
ATCAATAAAAGCCTTTCCAACATAAGAACTCTGCTATGTATCAGGATAATATTCCACAGG
AGAATTGGAATAGAAATAGAGTTTCAAGTAGAGAAAAAGAGGAATGTACCCTGAACTGAG
TCTCGTTCATAAGTGGCACTGGCCAAGGGAGGAGAGAGGGCTTGCACTCCAGACACGGGG
AGAGCAGGAACAGAAGCACCCGAGAGGAACGCTCCTGTGCAGAGTTGGAACAGCTCCCGG
AGCTGGAAGCAGAGAAGGTGAGAGAAGTAGGGCAGGCCCCGGGGCCGGCCAGCCAGAGGG
CGTGGTGAGCAGTGCTGAGGGTGTAGTTCCCTCCCCAGGAGCTCTGCGGGACAGGTCCCT
TGCCCGTCTCTCTTGCGAGGGCCAAGGCTCGCTACAGTCTGCGTGCTGAGTGGCCTGCTG
AAAAAGTCTGGGCTTTGGAGTCAGACTATTTATTTATTTATTATTTATTTCACGTTTATT
CATTTTCGAGAGACAAGAGTACGAGTGGGGGAGGGACGGAGACAGAGGGAGATACAGGAT
CCGAAGCAGGATCCGAAGCAGGCTCCAGGCTCTGAGCTGTCAGCACAGAGCCTGATGCGG
GGGCTTGAACTCACGAACCGCGAGATCACGACCTGAGCCCAAGTTGGACGCTTAGCCAAC
TGAGCCACCCAGGCGCCCCTGGAGTCAGACTTTCTGACTCTGTGACTGTGGGCAAGTCAT
TTAGCAGCTGTTTCCTCACCCATAGAAGTGGGGTAGTGATTCCCATTTCTTTACTATTAC
TTCAAGGATTCGGTAAGATAAGTATTTCAACACGCAAGAGGGAGTGCCCCACGCAGACGC
TCTCTCGTGCGCTGGTAACGGCCGTCTGCTCTGAGACCTTCGTTACACAGCTTCGCCAGC
GTGCGGCCGTGCGGGGTGTAGGTACTTCCTGACAGTTCCCCTTGGAGATGGGCTCCGGAA
TGCCCACTTGCCGGCAGAGCAGGGCAGTACCTGCAAGCCGAAGGAAGAACACCTATCTGA
TGCATCCTGGGTCTTCTGAGGGGAGGGAGGAGGACAGGGATGGAGGGTCCCTACCCGTGA
GGCCAAGAAAGGGCCTCCCGACTTCGGAGTTTTGCCCGGGGCAGGCCCTGTTTACCTTCT
GCTGTGCTCAGCCGGATAAAAAGCCTCTGTGGAGAGAGAGGAGGCCTGCGCCACGGGGCC
TGGCTGAAGGCTTGCTCACTTCTCACAGAGGGTTGCTGTGAGGAGAATTTCGAAGCCACT
GGACTGTGCGTCTTGGAGGATAATGTGGGCTTGTTTGAAGATCCTCTGTGGCTCAGCCGG
AACTATGAGGACGTGAATCCGGCACCAGTCACCCTCCAGCCACCTTACAGCTTTGGGGCT
CCTGAGATTTTTACCAGGCCTAGGACGTTTTACTTCCGTGAGTGTCGGTAGCCCCTCTGA
AATGACAGGCGCAGCCAGTCCCGTGTCCCGTTTTATCAGCGAAGGGAAAGGGACTATAAA
TAGGTATGGCCTGGATCTGGAATTTCCTAGGGAGAGAAAAGGCCAAAAGGAGAGTTGTTC
AAAAGGCTGGGAAGTGCGAAGGGGTGGGGTGGAAAATTCCTGGCTGACAGGCTTTCAGAT
TGATGAAGGTCTGAGGAAAGCCTGGAGATTCGTCCCTTTTTACCTCCTAGTATTTCACAC
TTACTCCAGAGAGGAAGCTGGGTTTCGTAAGAGACTAAATTTAATGAGTATTTGAAACTA
TTCTAAGTGGAACAAGAGAAAGGAAATTTGGATATCGTTTGCTTAAATCTTTTATTCAAA
TATACGTTTGGGGGGCACCTGGGTGGCTCACTCAGTCGGTTAAACTCTTGGTTTCGGCTC
AGGTCGTGGTCTTGTGGTTTGTGAGTTCGAGCCCTGCGTCGGACTCTGTGCTGATGGCGA
GGAGCCTGCTTGGGATTCTCTCTCCCTCTCTCCCTGCCCCTCCCCTGCTCACACTGCTTC
TGGCTCTCTCTAAATAAATAAATAAACTTAAAAAATACTTTGTTAAGTGATTACTATCTA
CAAGAAGTGTCCTAAGTTTAGGGAGATGGAATAAACATAGGTTTTGCCCTCAATGAGCTT
GAATTCTACTGTAAGAAGCAGACAATAAACCAAGAGAATACTGCGTTGTGATAAGTGCCA
CCGTAGTGTGGAGCCCAGGGTGCCGCAGGGATGTGTAGTGGGCGCACAACCCACGTCAGG
GTGAGCTTCCCAGGGAATGGCACATCTGGGCCAAGTCTTGGAAGGTGGGTGGGTGGGTGT
CAGCCAAGCCAAGAACGGGGAGGACCTCTGAGGCAGTGGGAGAGCCACGTGGGGGGGACA
CGAAAGGAAAAAGAATGGTTTGCTCAGGAAACAGCGAGCGCTGAGAACCACTGAGCGCGG
AGGTAGGGGAGAGTGAAGGGCTGGTCGCCAGGGAGGCCACTTTGCTCTTGGTAGGAGCTA
GAGCCTTGAACTCAGACGGTGCTAGGTCCACATCTCAGCCCTGCCATTTGTTGGCTGTGT
GACTTACAGTAGCAACAAGGCCTCTCCGAGCCCGTTTCCTCCTTGGTGAAATGAGGTTGT
TGGGGAAAACAGAGGAAGCAGACACAGCCTTTCCTGGGAAGGACTCCCTACTCGTAGAGT
GCTGTGAGTGGGAAGGGAGGACATGGACTTGGGGAATAAGGAGAAAGTCCAGTGTGTCCA
AGTGACCGATGGCTGGACACCTGAAGAAGCTACACACTGGGCAGATGCTAATTTCCTAAG
CTGGTGAAAACACAGTCTCATGATCACCCAGGCTCTGGATTCGGCCTTGGGGAATAGCTT
GGAAAGCAGTAATCCTGAAACCCCGGCCCAGTGATTTCTTACCACCGAATATGATGAGCT
TTGGAGTGGGATTTTTCATGACTGAAAGAAACGACATGGCAAAAAGAAGAGCAGAGTCTC
GAGTAAACAAGACGAGGTTGGTTTGGGCGGCCCGGCCCCTCCCACAGGGGTGGGGGAGCG
GGGTCAGTGGGGAGAGGGAAGGAGAGCCGCCTTTGTCCTTGGCCGAAGGTCTAGGCATCA
GAGCAAACTAGTTTGCTCTGCTGTTTCATTACATAAATTTAAGCTCTAATTAGCTCTTCT
CTCCTCCTACTCTTGCTCTTGCAGATTGGAAAAGGCAGGATGAGGCCCCCTCTCTCACTG
GCTCCTCCCTGGGCTTTGGGTTCTGAGTCAAATGCTAGAGCTGGAACCCCAGGAAATGGA
GACCGGTGCCCAGGAGCTGCCCCCCCCACCCCCACCCCCATGCCGGGCCAGGGATCTGTG
ACTTGGGGGAGGGCAGGGGGTGGCTGGGTGTGTGTATTTTGGTGGGGGAACTGCCTCAGG
GTGTTTACTTGGGGGCAGTTGCTCCTGAATCTGGAGCCGGGGCTGAGCCCAGATCGGCTG
GCCCTGCAGCGTGTGTCCCGATCTGGTGATCACTGCTGGGGAGCTTTCTTCTCAGGGTGC
TGCTCTCCTCCTCTGTGAACCGAGGCGGTAAGCGACCCTAAGCAGGGCGTGCGGGACCTG
TGCTGTGTCCTTGTTGTGCCTCCACTCGCCTAGTGAGTGTGGATGGACCGTGTCCCCCGG
TCAGAGCCCCTCCCCTGTGAGATGAAGGTGTGTGAGTCTGTGTCTGCTTATGCCTATTAG
TTGTTCCCTGTTCCAGGTGCCGGCCCTATTCGATGAGGTGGCCATATATTTTTCCGATGA
GGAGTGGGAAGTTTTGACGGAGCAACAAAAGGCCCTCTACCGGGAAGTCATGAGGATGAA
TTATGAAACTGTCCTGTCCCTGGGTAAAGCTTTGTTTTTTTCTTTGTCTCCTGGAAGCTC
TGAGCCCAGAGAATTGTTTCCATGTCTCTTCTCTGGTGTATCCAACATCCCTTTCTCCTG
AACTTGGACTCTGTCCCCCTCAATGCCTGTGCCCATTTGATTTCCTGTTTTTGACTTCGG
CAGGATATAAATATTGTGTCCTTCTACTCAGCAACTTGCGCCAGCTCTCAGAACCATCCT
CACTCGACCTAGGCATTCGCGTAAAAAAAAAAAAAAAAAAAAAAGACCTAACCTAAGAAA
TGTCACCACAGATCTGGGCCTGTGTTTCATATGTTCCTCAGGAGGGAAGGCAGACTTCAT
TGTTACCCCGTCAGCCTCAGACGCTTGGGAACTCAGAATCCCCAAAGAATCCTCTTTCCC
CCCCCGGCATTGATGACCCGTACCATTAGAATGTAACCAGCTGGAGGGATTTCCTAGTTT
CTCATCTAGGTACCAGAAGGTTCAATAGGTCAGGGACTGCATCCTGCCAAATGAAGTTGT
TTTTGTTGTTGCTAGCACCAGCCCTCATTAGCAGAGATCCCTAAATTCCCTTGGACCGAC
TTCTTTCCTATCATGTTTTTTCTTTCGTGACCCCCTCAGCCCTTTCCCCCTGGCTTTTGT
AAACCTCCACATGGAGAGAGAGTGTGTGTGTGTGTGTGTGTCGGGGTGGGGGAGGGATTC
CTTAAGTAGCATAAAGTACTGATTTTGGCAGGGCTCCAAGGCAGGAACACACAGCTATTA
CCTGTTTTATTTCCTATAAACAGAATTCCCATTCCCTAAGCCAGACATGATCACTCGGTT
GGAAGGTGACGAGGAGTCTCAGATCTGATGAATGGCAGCTCCAAGGAGGAACCTTGGCAG
GTACTACAATGAAATCACCCCAGCATCCACCCAGTGGGAGCATTGTGAACCTGGACTTTA
AGTTTCCATGTACCTCGTGTGGGGTGTTTAAGAGTTGAGGCAAGGTTATGAGGCAGAAAG
ATGATGGGCTTTGGATGTTCAAAATCTTTCTAGTGCTGTGTGACTTTAGGCCACTTCATT
CACCTCTCTGAGCCTCCATTTCTTCCTCCGTCAGCAGTGGGTAATAAGTCTCAATGTGCA
ACCTTGTACGCGCATGAAGTAGATTGAAGTTTGTATGGCGTTTGGTCCTGTGCACATGCT
GGGTGAAGGAGGCCACCTCAGTAGCGCACCATATACGTTTGAAGACTAAGGAAAGTAACG
CGACAGAGCACATGGCCGGGGCGATTTACCCTGGTTTCTTGTCCCTCTCTTCTTGGATAG
AAAAAGCAAGAGCAGCTGTAGTACATGTGTGAGTAGGTACGTCTGAGAGGCACATGGCCC
TTTATCAACAACATAGTTAGGATAACGGTTGGCCAAATACAGCTTCTAAGCAGCCAGTGA
TTTTATTCACCTTCTCTCTATAGGGAAGAGTTTGAAATGCCATATTTCATTGATTCTAAG
ACATGTTTCCCCCCGCCCACCACATTAACATCTCTGAAATTGAGAACTCCTCTTAAAATT
GATGGCATTTTTTTTTTCTTTTCCCATGGTGTATCTTGCAACTGATGGCATCTTAGTTTG
GGTGAGACACGCTATCTTCCCAAGTCCTGTTCAGTTTCTGCGACCACTTTGTAAATATAG
AAGTTCGGACATTGGTGTGAGGGGACGAAGTATGCTTTTGCTATAGATTTTCTTGGCGTA
AGGGACATGAGTCAGGCCATCCCTTTAGCAGTGCATCTAAATTCTGTACCTACTGTATGG
GTTACGTTTGGCTTCTCGTGCCCACAAAAACCGTTTTGACCAAAGCGTGGCCCACAAAAT
GATCGTGTGATCCAAGTTTGGTACCCGTGTTCAAGTCCCAGCTCTGGCACTTTGTAGCTC
AGCTCCCTTGATGTATTACTTGACTTCTGTAGCTCCACCTGCAAAGAAGGAGTAGCGATA
CACAGGTATTGTGGGAAGTAGGTGTGGCGATCCATAGGACTTAGGGGAACGTCATCTGTT
ACTAAAGGGCCTCCTTTGGGTGAACCTCAGATTAAGGTATTCTTAGCGTTTTGACCCAGG
AAATCGGAATAGGCCAGAAGGCATTTTTCTTACTGTCGTTGTGTTCGCCCCTCCCTGTTT
GTCTCCTAGAAAATGAAGAGACTGACGTCAAGCCCCCGGACTGGGCGGGTCCGATGAACG
CCACCCCCCACTTTCCTCAGCCACAGCACCTGGACGGCTTTGGCCTCCGCCTGCCTCGGG
ACCTCACGGAGCTGCCCGAGTGGAGCGAGGGGTACCGTTCTACATGGCCATGGGCTTCCC
GGGGGTACGACCTCTCGGCGGACGATATTGCCGGGAAGTTTCAGTTCAGCAGGGGCATGC
GGCGCAGTTACGACGCGGGGTTCAAGCTCATGGTGGTGGAATATGCTGAGAGCACCAACA
ACTGCCAGGCTGCCAAGCAGTTTGGAGTGCTGGAAAAGAACGTTCGGGACTGGCGCAAAG
TGAAGCCGCAGCTGCAGAATGCCCACGCCATGCGGCGGGCGTTCCGCGGCCCCAAGAACG
GGCGCTTTGCCCTGGTGGACCAGCGCGTGGCCGAGTACGTCAGGTACATGCAGGCCAAAG
GGGACCCTATCACCAGGGAGGCCATGCAGCTGAAAGCCCTCGAGATCGCCCAGGAAATGA
ACATTCCGGAGAAGGGGTTCAAAGCCAGCTTGGGTTGGTGTCGAAGAATGATGCGGAGGT
ATGACTTGTCCCTGCGGCATAAGGTGCCGGTGCCCCAGCAGCTGCCCGAAGACCTGACGG
AGAAGCTCGTCACCTACCAGCGGAGCGTGCTGGCCCTGCGCAGGGCGCACGACTACCAGG
TGGCGCAGATGGGGAACGCCGACGAGACGCCCATCTGTCTAGAGGTGCCCTCGCGGGTGA
CCGTGGACAACCAGGGCGAGAAGCCCGTCTTGGTCAAGACGCCGGGCAGGGAGAAGCTGA
AAATCACGGCGATGCTGGGTGTCTTGGCAGACGGGAGGAAGCTGCCCCCGTACATCATCT
TGAGGGGCACGTACATCCCCCCCGGGAAGTTCCCCAGCGGGATGGAGATCCGCTGCCACC
GGTACGGGTGGATGACGGAGGACTTGATGCAGGACTGGTTGGAAGTGGTGTGGCGTCGGA
GGACCGGCGCGGCGCCCAAGCAGCGAGGGATGCTGATCCTGAACGGCTTCCGCGGCCACG
CCACAGATTCCGTGAAGAGCTCCATGGAGAGCATGAACACCGACATGGTCATCATCCCCG
GAGGCCTGACCTCGCAGCTGCAGGTGCTGGACGTGGTGGTCTACAAGCCGCTCAATGACA
GCGTCCGGGCCCAGTACTCTAACTGGCTCCTGGCCGGGAACCTGGCGCTGAGCCCCACCG
GGAACGCCAAGAAGCCGCCCCTGGGCCTCTTCCTGGAGTGGGTCATGGTCGCGTGGAACA
GCATCTCCAGCGAATCCATCGTCCAGGGCTTCAAGAAGTGCCACATCTCCAGCAATCTGG
AAGACGAAGACGACGTCCTGTGGGAGATCGAGAGCGAGCTGCCGGGAGGAGGGGAGGGAC
CCAGAGAATGCGATACCGAGAGCGCGCCAGAGGGCAACTGACCGCTGAGGGGAGAGCCCA
GGTAACCCGCAGGCACACGCACACGCCCCGCACCTTCACGGACAGGCCTGTTCGTGTTCC
ACGGACACCTTCCCCCTTGCCGTGATTTTCTGTGCCTCCGAGAACTCTCAAGCCTGGTCT
GCCGTACCACGGATCAGAGGCCATCAGCTCTCCTTTAGGTCCAAGTGCCGTTGCCTGGCT
TACTTTGTGGGTGTTCTGCTCTGAGGCCTGGCCCTGCCAGAACACTGAATCTGAGGGCTG
TCATGTTCAAATTATTTGGGCCTGAAGGAGCGTGGTCTGTCTGACGTTGCTCAGTCCGCA
AAGAATTTGGTCTGAAGAGCCAGCTTTTTCCTTCCCCTTATAAATCCCGGGGAACGTCAG
GGCCGGGGTGTGTATCTGACACGCTTGGAGCGGCTGTGCTCCCTTCCGCTGGCCTCCGGG
GCCGGCCGGCGGTACGGGGAGAGCACCGGGCGCTGGGGCCTCCGCGCCCAGACTTCGCGT
GGTCTGCTCGGGAGCCCACTTGGCACAGAAAAACAATAGCGTAGGTCTGCTTCTCCCTAG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGCTTCAAGAGGAGTGG
GGGACGGGGACTAACAGCTCTAGTGGATGTGAACTTACACGTACCACCCCCTGCCCCCCG
CACCCACACCTTGGGAGAGAACAGCCAGCCAGGCACAGCGGGAAACCTACAGAAGGAGCA
AGCGATTCGTTTTACCCTCTTGCTCTCATTCCCCTAATTGTCAATTAATTTTTTTCCCTA
GACACGTTTAGTATGAAGAAGGTCATTCCTTCCTTTACAGAGGCCCCCAAACCGTCTTGA
CGTGTCTTCTTCCTTTTACAGCGTAACTAAGGGGTCCCATCCTAGTTGCTTTTTCCTCCA
AAGGAAATGCTAACCGAAATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1132, 7216..7342, 8123..8181, 8183..8219, 9489..9634, 9637..9663, 9665..10960
1001..1132, 7216..7342, 8123..8181, 8183..8219, 9489..9634, 9637..9663, 9665..10957
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved