Felis_catus Locus Poly:23:SNORD50
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:23:SNORD50
Felis_catus
Poly:23:SNORD50
GeneScaffold_1839
SNORD50, SNORD50
1001..1068, 1342..1411
2411
TTCACTGCAGTATTGTGAGAAGATTAGAGATTTGAGTTTAGGGTGCTGTGTGTAGAAAA
CTTGCACGTGGAAAACACGCAGCCGGGCCGCCACGTGTCCTGAGTGGTAGTGGTGGCGGC
AGGCTTCGAGCTTAGGCGTGTGGAGGCTGGTGCTGATGGCCACGAGCGCTGTGCGCGGCC
TGCTTGCTAAACGCCGACATCCGGCTGGCCAAGCCTGAGCGGCGGCGGGAAAACCATATT
CCCGGTATTTGGGGCAGGGAGTTTTACGTTGAGCAAGAGGCCTTTAATAAGGAGAGTGTC
GTTTTCTCGTCGCGGATCAAAAGGTCATTTGAAAATGGGCAGCCCTGACGTTGCCTGAGA
TTGAGTTGTATTGTGCCCAGGTGGCGCTGTGTGCAAACCAGATTAGTGATTGGGAAGATT
TTAGTACTGAAAACCTTCAATTGTCATTCTTCATTCTGTAAGAATGCTTAGTTTTAAATA
TTTTGGTCCCCTTCATGAACAATGGCTCTCAGTGGCATAACGGAGCTGTTACCTGGAGAT
GTTCACGTAAGTACTGTTGAGCTTAGTTTTTAAACTGAAGAAATAAACCTGTTGATTTAC
AGGAAAAGATGGTGCATCATTTGAAATTTGCTTCCTACTAGATACAAAGGAAAACTAGAA
AATACGTGAGGGAATATTTGCTGGGAAATTACTTGGTTGGAACCTGACCATTTTACCCAG
GTATGTGTTGAGCTAATAATTTGATTGTTGGGCTACTTTGATTCAGTGCGATTAGTCCAT
ATGTAGATTAAAATGAAAATTTTTTTTGTCCTTGAACAGCATCCTGGGAGTTGATGAATA
CTAACAGACCTACAAATGTCACTGGCTAGCAACGTAATTTTTAAAGTAAGTTGTGTGACT
TACAAGATCAACTGTAGTGTTTCTAATATAGTGCTTACCTCTTAAAGTTGCTTTGGCTTA
CGGTAAATTTCACTGTAACATAATTTAGTGAATTATGGTCTTATCAATGATGAAATCTAT
CCCGAAGCTGACCACCTGAAGAAAAACATACGGATTCGGCTTCTGAGATAAGACTGAAGT
TTTTATAGTCTGGATTTTATAACTGAGAGGGTTCTGTTAGGTTATAAATCTTGTAGGGGG
AGAACTGCTACCTCAAAATGTGTTGTGGGTTTTTTTTTTTTTCCTCTGCCAACAGTGAGG
GGTCGCTGTCTTTCCATTGAAAGAGGCCAGTTTGCTGTGACCTTCCTAAGATGTAACCCG
TTTCTGTGAGTAGAGATTTTTTCCCTTCTGTGAGTAGAGATTTTTTCCCTTAACAGTTCA
TCAGTACTTTGTCCTTGGTCTTAATCCATGATGATCTTATCCCGAACCTGAATATCTGTT
GAGAAAACTTATACGGATCTGGCTTCTGAGATAGACCGTTATAAGGACAATGATATTTTT
AAAAATTCTTTGGCTCTTTTGATGTTGGTAGTCTTGTAAATCTCAAATGTTTTTCCTTTT
CTAGGGTTAATACCACCAGATTTACTTGTGAAAAATCGATAAGGAAAAGCTCTTCATTTA
ACTGACATGGGAAGAAAACCTACAAATCAAGACGATATTTTTTTATTTCTGTAAACAGGT
TATGAAACCGCATCAGATTCAGATTAATGTATTTGTAAGATTTAAGCCATTACTTTTTAT
GTCATACTGCCCTAGAGAATCCTAACCTGTTAAGCAGATTACTTTGTAGATCTATTTCTA
TTTTAAATACAGGAATGCAAAGGAAGGTACATATTTTTAATGGAGAAGTCTTTGATTTCA
GTTAACCAGACTTGTGATCAGCTTATTGTGAATGTTTCACCTTTGGCCACCTGTTTGAAT
TTAAAATCTACGATTGTAATTAAAGCTGAGTGAAAATTTACACTGAATATTGTGGAAAAG
TCCTTAGATTTTTATGGAGAGATGACTCATTTTGGCAGTATCACACGGTACAGATCATGT
TGGGTTTTGTAGCGTACTGAATATTACTGGATTAGTGGTGAGCAAAAGGGAAAGACTGAG
TCTATTACTGGGGGAGGGGAAAATACCAGGTATTACTGGTTCTAATTACTGAATTCTGGA
ATGTTTGGTCCTAATGAATTATAGTTTGAAAGGATGCTTAAGATGGAAAATGTGAGGGAC
ACCTTGGTGGCTCAGTAAAACATCTCAGCTCCTCCATGCTGGGCATGAAACCTACTTTAA
AAAAGATGGGAAAATGTGGAATGCTGAAAATGAAGAGAGCACAGCATGACAACGGGTCAT
GGGGGGAAGTTCACTGATAAAACCAAACATTGCATAGAATGGATTTAGTGTAGACAGTAA
TAGCATCTGATCTAACCAAGATGGTTTGGCCCCATGCATGATCATTTTCCCTAAATAGCT
ACATGAATAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved