Felis_catus Locus Mono:92:SNORA43
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:92:SNORA43
Felis_catus
Mono:92:SNORA43
GeneScaffold_2746
SNORA43
1001..1127
2127
GCTGACAGTGCAGAGCCTGGAGCCTGCTTCGGATTCTGTGTCCCTCTCTGGCTCTGCCC
CTCCCTGCTCAATCTCTCTCTCTCTCTCAAGAATCAATAAATATTAAAAAAAAAAATTTT
GAAAAAAAAAAAAGATCTGAGCCACATAGAATTGCTTTTGCTTTCCAGCTCTGCCTTTAG
GTCATGATGTGACTTAGGAAAAAATTACTTGACCTCCGTGAAGCCCTGCGTTCTTCATTT
GGGAAGGCAGGGTGTCCGCCTTGCGTGGTAAGTGTCGAGCACGATGCCTGACACACTGCA
AACAAAGCCTCAACAAAGCCGGCTGTTTGAAGTCATCGTCACCACCATCACCAGCAGGCT
GATGCGCTGTCCTTACAGACACAGCCACGGTACCAAACGACAGTTAAAAGGAACTAGCCA
CATAAGGCACGTCATTACACTGAGGCACACAAAAGGAGAAAAAGGTACCGGGATATAAAT
AGGGAGTGTTAATACGATTAATACAGTTCAGCCACAGGATAAATGTAAATTGCGTGATGG
ATGAACGGGGCAAGGGAGAGCAATCCTGGGAGCTGCACGCTGAGGCTGAATGGCCTCACC
TACTCTGTAAAACCTGTAAGTCAATATCTGCCCGACATTTCTAATGTGCCTAACATGGCA
GTCAATTATGAGTGACTGAAAAGAAACTGAGGATAAGATATCATCCCTAACCTCAGAAAC
CCAACAATCTCATTGAAAGGTTACGAACAGAACCTGAAATACATGAGGACATCCTGTGGT
TCTGCAGACTAAGTGCAGTGAGTGTCCAAGAAGGGAAAGAGCTAATGCGCTGGAGTCCTT
GGTGAGAAATTCAGGGGAGCACGGTCGGGGGAGGGTGGGGACGGGGAGGAAGGGGGCAGA
AGCTGAGACAGGTGAAGGACATCAGAGAGAGAAAAGGGCTGGGAGCAGGGAGTCCTCCGA
GGATGCCACCCTAGAGGGACTCTGGTCAGAGGACGATCCAGATTGCCCTGCAGGTGCCGG
ACCTGCTGTTCTGCTGCACCTGTGACGTTGGGGCAAAGAGGAAATGGCTGTTTCCACGCT
CAGCGCTCACAACAGTGACCACTAAGCACGGTCTGTAGCCCCACGTGCCCCACAGCTGCC
ACGGAGGCAGTTTTTATGTGCATGTGGCAGGGAGACCTACCTTTGGGCTTCTAGCTGGGA
ATGCCGAGCAAGGCACTAACCGCTTTGGTTTTCAGGTTCTTTGTCTATAAAAGAAGACTT
GTCATGAGGGTTACAGGAGATGTGCATAGAGATGAGCATGTGACCGGCCTCTGGCACAAC
AGGACTGACCAGGAAGAGGGTCTTCCCCTCGTGGAAGTGCTCATTCTGTAGGTCTGTCTG
GGGTAGGGCTTTCTGGAAGTCTGGGCAAGTGTGTTGTGTACCCCTGCTGCTAGGAGTGGC
CTGTGTCCTGCTGTTGCTCCCTGCGGGGGCTTCCAGGCCCTGTGCCCACACACCCTGCTC
TAAGGACACTTGAGACAAACAGAGAACTCTTAGCCGAACAGGAGGCAGGCTGGGAAGGAG
AGAGACAGCAGAGGGCCACACCTGGCTTTGTCCTGCCAAGGAGACATGATGGGGCGACAG
GCAGCCAGCAGTGGGCTAACTATAACCCTATAAGCAGCCCTCTAAACCAGGGCACTGGAG
AGTGGAGAGGGGTTGGTTTTGGTAACCCCACTGCGGGTAGCGGGTGTGACCACGGCTAAA
AAAAATAAAAATTTTAGATTAAAAAAAAAAAAAAAAAAGAGGAACGTCCAAAATCAATTC
AACTTGTACAGAATGCCTACTACCAGCCTGCTAATGTGTTAGGCGCTGAGGCACAGAAAA
AGAACAAGCTAGTCTCTGTTCTCAAAGAACTCAAGGCGTCCCGACGGAAAACGAGGGAAG
CGGGACGAACAAAACCTCGGGTATCACAAGGCAGTGCGACAAATGCTGTTAACAGAGACT
GGTCATTCCATATGAGAGGGCCGGAGCACCGGGGATGGCAGGCACCGGCCAGGGCTTAGG
TAGCAGGCAGGGTTTCGTGCGGGAACGACCTAGAGCTTAGAGGCCCTGCACCCCAGTCCG
TTTACCTTCGGAGGAGAGGAGGCAATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved