Felis_catus Locus Mono:60:SNORA70
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:60:SNORA70
Felis_catus
Mono:60:SNORA70
scaffold_205072
SNORA70
1001..1128
2128
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTGAAGTCAGATACTCAACCAACTGAG
CCACCCAGGTGCCCCTCCCATACTTTTAATTTTGTTTCATATATTTATCTATATATTTAA
TTTTGTTTCATATCTATTTGCTGTCCCCAATACCATACTATCTCATTATAGCTGAATAGT
GGGTCTTGATATCTGATTGTGTAAGTTCCTCCAGCTTTGTTCTTTAAGGTTGCTTTGGAC
TTTTGCATTTCCATATAAATTTAAATATCAGCTTGTCAGTTTTCATAACAAACCTGCTGC
AGTTATTTAAAAAATGTTTTAGTTTATTTATTTATTTTAAGAGAGAGAGAGCACGAGTGT
GAGCAGGGGAGGGGTAGAGGCAGAGAGAGAGAGGGAGAGAAAAAATCCCAAGCAGGCTCT
GCACTGTCAGCACAGAGTCCAACATGGGGCTCGAGCCCACAAACTATGAGATCATGCCCT
GAGCCAAAACCAAGAGTCGGTTGCCTAACCGACTGAGCCACACAGGTGCCCCAAATCGGC
TGCAGTTTTTATTGGGATTTCATTGACTCTATAAATCAAGGATGAATTGACATATTAACA
GTGTTTCTCATGGGGGCCCAGTGTGCAATGGCTGCAAACAGTAGCCTCCTTGGTAGTGTA
TGCAGCCTATTGATTGTATGGGTTGCCCTAAGAGACCTTGGAGACAGCCCTTTCCAGTAG
ACATTGATGTCTGACCTCACGCTATCACCAATTTAGGCTCCAGACAGGTATGAGGTGTGC
CAGGGTCCACATTAGCCAAATCATCATGTCCATCTGTACCAAGCTACAGAATAAGAAGCA
TGTGATTGAGGCCCTACACAGGGCCAAGTTCAAGTTCCCTGGCTGCCAGAAGATCCACTT
TCCAAGAAGTGGGGCTTTACTAAGTTTAATATAGATGAATTTGAAGACATGGTGGCTGAA
AAGTGTCTCATCCAAGATGGCTTTGGGGTCATATACATCCCTAATTGTGGCCCCTTGGAC
AAATGGTGGGCTCTACACTCATGAGAACCTCGGCACTGCCCCCCTCCCTGTTCATGCCAC
CAATAAATCCTTCTTCCTGTCAAAAAAAAGTGTTAACAATATTGAGACTCTAACCTATGA
ATATAGTATATTTATACATTTACATAGGTTTCCTTTAATTTTCTGTCAACAATATTTTCT
AGTTTTCAGTGTAAAGATCTTACATATCTTTTGTTAAATTTATTCTTAAGTATTTGATTG
TTTTTAGGTGGTACTGTATATTAAACAATTTTTTTTTACTTATCCTGATCTATATAAATT
AAATTGGTTTTTAAACTTTGGGCTTTATATCAACATTGCTAAATACACTTACTAATTCAT
TGTTTTAGATTCTTTTGGATTTCCTATGTAAACAATCATGCCTCATGTCAGTGATAGTTT
TTTATTTCTTCATTTCGACTCCTTATGCCTCTTATATGTTTTCCTTGCTTGATTTAACTG
TCTAGGACCTCCAGGACAGTGTTAAATAGAAGTGTTGCTAGCAGATATCGTTGTCTTATT
CTTGATCTCAGGAAAAATTTAAAAAGTATCAATTCAAATAAAAAACAATTTTTTTGGTAG
TTACTATTTATTCAGACTAAAAAAAGTTGCCTTTTCTTCCAAGTTTGCTGTGAGTTATTT
TTAAAGTCAAGTGGGAGCACAATTTTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved