Felis_catus Locus Mono:16:SNORD64
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:16:SNORD64
Felis_catus
Mono:16:SNORD64
scaffold_2980
SNORD64
1001..1067
2067
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAAAGTTAAAAAGTACAGTTCTTGACATTAGTAATTTTATTGTCTA
TTAGGAAACCTACATCAGGAAAAGCAGTGTCTGCTCTATTCTTTCCATGATATAATTTTG
ATTATATTACTATACCAATTTGGTTTGTTGTATCCAAGATCTTAGAGCTCCTTCAGAATC
ATCAGTGCCATGTAGACTTTTTACTGGAGTCTGTGTTTCATCAGTTTGATCTGTCTTAAT
TTTATTTGACCATTTACATTGATTCTCACTTGACTCGAATATTTTGAATTAATATTTTGA
GACTCAATGTGGTCTAGGTCCTTAAAATATTTGAATATTTCATTTTTCAGTTTGGATGAT
ATGCTTGTAGAAGTGGATCATAAGCTATTTAGTTCTAAGACAGCAAAGATCTTGATACAA
TTCTGGCACATTCTTGGGGTTTTATTGTCTTTAGTTTTTCCCCATATTTTCACCTTAATT
CTGTGTCAGTTGAATTATATTGCTATTATTTAACTTACATTGCTACATAAAGATGATCAC
ATTCTCCTAAGCTAAAAGATAATTGCATTATTAGAGATGTACTGTCTGAAGGTATTAATC
CTTTTACAGAGTTGTAGTAGTTGTTGGGAAAGACCTTGACTGGATTTATGATGAGTTATG
TTTACTGAGTATGATGAAGTGAAACTCAGTGTGAGTACTCTGAAGTCCAGCCTAAGTGTC
AACCCAAATACTTAGGACATAAATATTCTGAAAATAAGTTCTTGCACTGTAAATTTTGCA
AGATATTTTGAGCAATATTGTGCATATTAGGGAGAATGGAACTGTAGGTTTTTCCAGTGA
ATTAAAGAGAGGTGGATTCTAAATTCCACTACTGCAGTTTCCTTTTGTAGAGTTATCTTC
TGTGTTTGTAGCATTTGTATATCTCACCTTCGTCTTTTTCATTATGAGTTTCAAGTGATG
AATTTAAGAGAGTAAAAACTTGGTAGCTACTATGCTTTTTTCTTTATATTAAATACTACT
ATAATCATTTAGTTCCAACCTCATACCTGTTTCCTGAGAGCATGTCCCTAAGCTATGAGG
CAGCTCCAAGTACAATATGAATAAGAAATTGCTAGTTGTTGAGATACTGATTTGGTCTAA
AATAAGACTTGTGTTTTCAGCAGAATGCTAAAGATACATTGAGATGAATTACTTTATTTT
TGTGTGTGTGCACACTTTATTTTCTTAATTTATTTTTTAATTTACATCCAAGTTAGCATA
TAGTGCAACAATGATTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved