Felis_catus Locus Mono:120:SNORA9
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:120:SNORA9
Felis_catus
Mono:120:SNORA9
GeneScaffold_93
SNORA9
1001..1132
2132
CTAGAAAAACCTAGCCTTCCAGGAGATCATGAGCAAGCCTCCTAACCTCTTTCGGTAAA
TGTTATTTTCCATGTGAGCAATCTGTAAGTAAAACTCCTGCCCCGTCTCATGAGATTTAA
TAAAATACATAATGGGATTCGTATACGCTGAAGTGCTTGAATGGAATTAGCAGGTGCCGT
AAGTAAAATGAGTTTCGAGCACTGCTCAGCTCTTCTTTACTTACAGAACTCCGTTCTCGC
CTTGCGAGCCTGATCCCTGATCGCAGACCCCCGAACGTGCAGTCCTTGCCCCCGGTCCCC
TCGGAGAAGGCCCTACAATCTCCGACCAGCCGCACCCTTTCCGGCTTCAGTACCTTCCCC
GGCGCGGCCCTCCCAACCCAGTCAAGCGCTCCACAAAAGCACAAGAGAAGGAAATACTTT
TATTTCAGCGAAAGAATAGACCGGGACGGGTTGCGCACCACGGGCAAACTGCTCACGGGA
GGCGACGACAAAGAAAGCGCTCTCGCGCTCAGCCCAGCGGGACCGGCCCTGCCCGCCGGC
CGTGCGCCCTCCCCGCCCCGGGACCCCGGATCCCTGAGCTGTCAGGGACACCACTCGAGC
GGAGAGGGCCGTGAGGCGGAAAGGGGGGTGCGCATCCCGATGGGAGCGGACAGGACGCGG
GCCCCCCACCCCACGCCCCAGCGGCCCGGGACAGCCGTTACCCGACTTCCGTCCGCGTCC
TCCCTGTGGCCGACTTCCGGCGCGCTGCGTGACGTCATTGCGGCCGGCTTCCGGCGCGCT
GACTTGTGCTCGGCGCTGCCATGTGTCGCTGGCGACAGGAGGCTGCCGGGCGGCCTGGGC
ATCCGAGGCCATCGCGGTACCCGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGGTGCCCAGGCCTAGGGGCTTTCGGGCAGGTGAGCGGCAAGCCTCCAGCGTGC
CTGGGTCTGGGGTGGCCCCGTGCATTCCTTTAGTGCTTGCAAGAACATTGGGAAACGGTT
TGAGGCCTTGCCCTGCTCCATCCAGAGCAAGGTTATAGACATTTCGAACAGATGACCGCG
TTTTTTCCATTTCTGATGTGCTGCACGTTGTAAACATCTGCAGTTGCCACGTGAGTTTAG
AGGAAGTAAAGTTTCAAATCCGGGTTTTTATTCACTGCTCACCTGGCAGGTGCTCAGGAG
ACACACCTTTGGCAAGTGGCTACTGTTGGAGACCATGCAGCTCACAGAACGTTCACATCT
ACAGAAGTTATTGTGGATTTGGGGGTGTTTGCTGTGTTCACGCTCGCTGCAGATTTTATT
TTATTGTCCTTAAAAGCCTTGCAAAAGTTGGAAATGAAGTTTAGGGGGAGTGGTAAAGGG
GGAACCTCCGGGAATGATGAGTGGAAAACAGTGCCAGACGAGCCCGGTGGGATGGATGGA
TGGATGGGATATCACAAGTTGTAGGGAAAAAACGGTGAAATTCTGCAGTGGGGCTGCTGG
AGGGTGAAGCCAGCGTGTGCTCATCTTAAAGGAGGGCACCCCTGTTGGTCTTTGTTCTTA
CCCCAGTTCAAATCCTTGGGGACCCCCGAGAGGTGGTCTTGGGTCCAATATGGAACAGGG
GCCCACGTCCAGGGTTGCCCAGCCAGAAACTGGCAGATCGCGATTGCACAGCAGGCCTCT
CCCACCCTACTTACTGTCTGCCCTTTTCCAGATGCCAGACCCAGAGGGAGGAGTGGAATC
TGGAAGCAGGTGGGAACCTTAGGTGGGAGGGGAATGCCCAGGGTGTCCTGGCCTTGGTGG
AGGGCTGTTGGGTGCTGTCAGGGATGGGCCAGTGTGGTCATGGCAGGGCAGCATACCTCC
TCTGGGTGGCCGGGTCACACCACGTCTCCTCTGAAGGTTGAGGCTTTCAGCAGACTTGGG
ATCTGCCTCTTCAGTCCACGTGCAGACGCTGACCACACCGGCCTCGAGGACACACACAGT
CTCATGTTTCTGCGGTCCTGTGAGCAAGGCGTTGACTGAACTCTGGCCCATCTTCAGATG
TTCAAATAGCAGCCAGCTTTGGGACATACAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved