Felis_catus Locus Poly:9:SNORA62
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:9:SNORA62
Felis_catus
Poly:9:SNORA62
scaffold_182740
SNORA62, SNORA62
1001..1144, 4755..4898
5898
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGCAGCAGTGGAAGAAGAATTGAGAGTTAATCAAGCTCAGGGTAT
CATTTTTAAGATTGAGACGATTTCCCTGTTCATGGTTTGGTCAAGGTTTGGTTGTGAAAT
AGAAGGTATCATTTATGGAGACTGAAGGACTCTCAGGTTTATGGCGGAAAACAATTCAGA
TAATGACGCTTGATAAAGAGCTCTATTACATATTCAAGTACAAAAGTCAAGCAGACATTT
ATAGTTACTGACATCTGAGTTTAGGAACACAATGAATGCTTGAGATATAAAGTAGGGAAT
TACAGGTGTAGAAGATGGTATTTGAAGCTTTGAAATTAAATCAGACCATCCGGATGTGAG
TGTAAATAGAAAAAAAAAAGAAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAG
GAAGGAAGGAAGGAAGGAAGGAAGGAAGAAAGTTGTGCCGGTGAGCACCATATGCTCCAA
GATGTAGTGATTCAAAGAGGAGAAAAACGTGCAGGTAGTGTGCTACATGAGGGGCAAGTC
TTTCCTAACACCACAAGGGTCTCTGTCCCAATTAATGGAGTTTGATAGTAATTCTGGCTA
CGAGTTAAAAAAAAAAAGGAGAAGAAATCAGAGGAGTCTAAAAAGGAACCACTTGTGAAG
TAAGAGTAAAATTATGTGTGCAGGGTTCTGAAGACTGTTGTAACCCAGAAGTCAAGAAAA
GAAAATATTTGAAAAAGGTGAGATAGACCAATAGTGTTAAATGTTAAGAGATCCTGTAAG
GGAACACTGTGGATCATCCATTGGGTTTCAAAGATAGAGATCCCAAAGCACTTATACAAG
AGTAACTTTAGGGGCGCCTGGGTGGCTCAGTCGGGTTGAATGTCCGACTCTTGACCTTGG
CTCAGGTCATGATCTCACAGTTCATGAGGCTGAGCCCTACATCTATCTGCACTGACAGCG
TGGAGCCTGCTTGGGGATTTTCTCTCTCCCTCTTTCTCTGCACCACCCCTGCTTTCATGC
TCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCCCAGCAGCATC
TGGACTACTGTTTGGCCATAATAACTGGGCACCATAGTATAGTCAAGTTGACACATAATA
TTAACTAACCATTGCTGATAGTATGTGAACTAATTGTGTACAGATGATTTTAGAAAAGAC
ATTGATCAACTTTTTGAAATAGTTATTTATGATATTTGTTTTAGTGTGACTTGAAAAAGC
ATAACTAAAATACCAAACCTATGATATTAAGCAGATTATCGCAAAGAATATTTTCAAAGC
TATGTAAGATAAAATAAATGTATTAATTAAGTGATAGTCCAAGCTGTATGTGTCAAAAAC
TTGAAGGTGATACTAAAATTAGTGAAGTTTGGAAAATCCCAGCCTAAGACCTTGTACCAT
TACAGATGAAAATATCCTTCACTGTTAATAAAACTAGTAGACATTTTCCAAGGTAGATTT
TGATGAATTAAAGTCATATGCTAAGGACAGCATAGGAGACACATTCTTTGCAGTTAGAAG
TGACCAATGATGTAAAAGCAGAGATTGGGTAGGACCTCTGAGAAGTATTTTGTCCTTCGC
CCTTCCTTTTTCTACAGCTTAGAAAGATGCTATGATAACTCCAACAGCCATACTGAACCA
CAAGTCAAGCTTAGGATGAAAGCCACATGCTAAGCGTGGTAGAGTAGAAAGAAGAAGTAG
TCGGGGCCCTATTGTCCATGACACCAACATACTATTCCTTGGCTTTCCACCTCCAATTTC
TTATACCTGAAGAAAGAAATAAACCTTTCTCTTAATGAAGCCGCTTTAACTGGATTGCTG
CTTCTGGCAGCTAAGTGCCATCCTTAGTGCAACAGAAGGACTTCTAAGAAATTGGAAAAG
GAAAAACACTTTTACCAGCTGGTAAGTTAGGAGAGATGTTAGAAACAGACATGAAAACAA
ACTGCTAAACCATTCTAAACAAACCCTAACTCAGGAAAGAAAGTGAAAGTTTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGTGGCTCAGTCAGTTGAGCAGTCAA
CTTTGGAGCAGGTCATGATCTCAGTTCGTGGGTTTGAGCCCCATGTTGGCCTCTGTGCTG
ACAACTGGGAGCCTGGAGCCTGCTTCAGATTATGTGTCTCCCTCTCTCTCTGCCCCTCCC
CTGCTCATCTCTGTCTCTGTCTCTCAAAAATGAATAAACATTAAAAAATTACAAAAATAA
ATCACCCTAAATGTAATTGTTTCTCTACTCCAAAATGGTGTGGTACTGTTGAAGTTGACA
GATAGAAACAGAGATAGAATAGATATATATATATCCAAATGTGTGAATAATGGAAACAAA
AGATCTTACAGAACTCCATGTGTGGTAGAAATACAGTCTGAGCATTCCACATGGTTTCTC
ATATCACAGTATTATTCTTAAAGTGTCTTTCTTATTTTTCACTTATTCTATTATTCACTT
ATTCTATTATTATTCACTTATTCTAGATCATTCATTTTCATGATGTTTCACTTTATTTGA
GAAAAAGAGAACGAATATTTACATGAATCTTTTAGCATTACTGGGAAAAACAAAGTAACA
ATCTACTCTTAGAAGTGCCTATTTATTAGCATTTATTTATGCAAGTAGGAAAATAAAGGC
AGGTCATGTGTAAGAAGTGCCACGTTGGTCAAATACCTCCTGATTTGTATTTTTCTCTTC
ATAAGCTTCTTTCTCCTTTCAATCACTATATACCACTAAGATCTCAAGAAAGGAAATAGA
TAAATATTATTACAGAAAGGAAACACTGATTTAAGGGAGATCCTGACAGAAGACATCTTG
GAAAACAGCTGGGGATGACAAAAAAAAAAAATTGACATGTTGAACAATCCCAAAGAGAAT
ACATTACCAAGTTATCAGAATTAAAATTGTTTGAGTTGCTGAATTTGAATGAGTTTACTG
TATTATAAATTAATATAGAGAGGTCGGCATGGAAGGACATGAGAACTGTGCTAGCCTACA
AGGTCATAGCATTGTAAGAAAAAGCAGATAAATTATAGGAAGTAAACACTATTATTTGAA
TACATAAATATCAAAACATAAATATTTAGCCCTAATACATGATTTCACATAATGGGTTTA
TTATTCCTAGAAAATTTATTTTGTGAGGAAAGGATGTTAGTCCAATGCCTTACCTCATAA
TTCTTCACCCTTTCTATATATTAATATGGGGGGGGGGATGCAACTTTTCCCCTTTAAAAC
AAAGGTTGATGTTAGCATAATACGAGCCTCTCTACTTCCAAATTTCAAATGATGAAATGC
AAATTTTGGAATACCAGGAATGACCAAAAGGATTTTTTAAGCATGTGACTTCAATTAAAG
CTAGATGATACGTTAGGCTGGGAGAGAAAATGTGATTTGGTAAAAGCAGCTTCTCCACCC
TCAGTAGGCTTGTCCTTGCTTTTATGACACTCAGTAAGAAGGCACTTTACCTTTGTTTTT
AGATTAAGTACGATTTGTCCATGTTCCTGATGGCTCTCCGGTGTCATCTTTGTACTGTAG
CGATGTTATAGAAGAAAACACAGAGCTGATCCATATCCATATCATTTTGAAGGCAATCTT
TTTCTACCTATTGATGGGCCAGTTTCTAAAATAGTATAACTGAAGATGGAGATTAAGCTC
CATTTTCCTAGATGACTCTTATAAAATATCAATGAGAGACAGATAGCAAGAATCTGAAAG
TATGGCAGTATTTTACAACTAGAATTTTTTTTTGCTTTTTTTTTTAATTCTGAAGTTTTT
CTATTAGGATGTTCCTTTAAAGGCGGAATCAATGATGTCAAGAACTTTTCAGAAACCCCA
TGCTCTGGATTTCGTGATACAATAAAGCTTTTGCACAGATGCCTGCTATTTATTTACTTA
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGAAGGAAGGAAGGA
AGAAAGTTGTGCCGGTGAGCACCATATGCTCCAAGATGTAGTGATTCAAAGAGGAGAAAA
ACGTGCAGGTAGTGTGCTACATGAGGGGCAAGTCTTTCCTAACACCACAAGGGTCTCTGT
CCCAATTAATGGAGTTTGATAGTAATTCTGGCTACGAGTTAAAAAAAAAAAGGAGAAGAA
ATCAGAGGAGTCTAAAAAGGAACCACTTGTGAAGTAAGAGTAAAATTATGTGTGCAGGGT
TCTGAAGACTGTTGTAACCCAGAAGTCAAGAAAAGAAAATATTTGAAAAAGGTGAGATAG
ACCAATAGTGTTAAATGTTAAGAGATCCTGTAAGGGAACACTGTGGATCATCCATTGGGT
TTCAAAGATAGAGATCCCAAAGCACTTATACAAGAGTAACTTTAGGGGCGCCTGGGTGGC
TCAGTCGGTTGAATGTCCGACTCTTGACCTTGGCTCAGGTCATGATCTCACAGTTCATGA
GACTGAGCCCTACATCTATCTGCACTGACAGCGTGGAGCCTGCTTGGGATTTTCTCTCTC
CCTCTTTCTCTGCACCACCCCTGCTTTCATGCTCTCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTTCTAATCGAAGGAAAGGCAAGTGGTATGCAAGTATCCAGGCTC
CGATCTATGGATACCCCTAACAAATCCTTTAAATCTCACCATTAAATAAAGAACAGTAAC
TGCATTTAAGAGCTCCTTTTATTTATGGACATAGTTAATTAAAAATAAAAGAGTACCCTT
AATTGAGAACTCCATTTCCTAATATTTATTCCTTTGAACCACCTAATTCCACGGCAGATA
ATGTGTATAATCATGAGAGAAAAAACGACAAATCATCAGACCTTTCTTTTTAAGTTTGGT
AATTTTCAAGAAACTTTGTTCTCACACATAAGGAAAAACAAGTGAGAATATTTGTATTGT
CTGTAGTTTGCCCTTTTCCAATTTCAAAGCTTTAACCAGATCTTTAATTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTCGCTAAAAGAGTGTTGCAGGGTAGGAAAACAAAATCTGC
TTGAAGCCAAATCTTGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved