Felis_catus Locus Mono:52:SNORA70
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:52:SNORA70
Felis_catus
Mono:52:SNORA70
scaffold_197266
SNORA70
1001..1111
2111
GCACACAGCCACCTACAATCAAAACAATAGCAAGCATGCTTTCTTTGGTTTGATATACC
TACTGAGAATGAATTTGGGGAGGATCAATCCATGGAGTCTTCTCTGAGACTCATCAAATC
AGAATGTTCTTTTCCGAACATTCTTTTCCAAGAGGCTACTGTGCAATTTTCCAGCATGAC
TCCTACCAGGCTTTGGAAAGGCTAGAAGTAGTTACATCTGTTAGTTAATTGTTAATTATA
ACATCTGTAATTACACTAAATTTTGCATTATCTTCCTCCAAGAAGTGTACAAATTGCAGT
CTTCTCATACAACAATCTAATTAAGCAGTACTTTATAAATGAAGTTGGATATTTTTTATT
CCATAAAAGTCTTGGAATATACTTTTATTCACTCCTAAAGAGATGGTTGTTTTTACAACC
TTGAAAATTTAAAGCCTAAATATCATAAGAATCTTTGAAATCTTTCCAGGATTTTATTAT
TGTAGGGCAATATTGCCCATAGTAGATAATTATTTAACACTTCATGGGTGTAAGAATCCT
CCTGTTCCCCAACCCACCTTGCCATAGGCTGCCCTTGTAGCTGCCACAGCTCTGAATGGA
TTACTTTATTTTTGTTAGCCAGTTTTTCACTTTCATCTCCATACTGCAGTACTTGGTAAT
GTAACTGTCTCACTTTTAGATTCTGTTTTCTTAGTATATGGATCATGGCGGGACACTGAG
GATCTGTCTGTGCCACTTCTTCCCATTATTTTTAAATCTTTGAGGTGGAGAGGCTTCCTG
ATTGGCAGATATTTTCTTCTGAACAGTAGTGTAACCAACATTGGTGTCCACTTTTACAGT
CCTGGGATGCCCTTTCTGCTCCCAGTGTTTACAATGCTGACATGCATCACCTACTATTTT
GTAAATACTATTGAGCTTATGAAATCTTGCTCTGTGTTCTTGCTCTGTTTACTAATATAA
CCCACATAAATATTCTGAACTTTTAGAGCAAATTCTCCTTGATGCACAACTGGCTGAAGA
CTAGAAGGATACCCAGGGTGCAACGGCTGCAAATAGTAACCTCTTTGGTAGTGTATGCAG
CCTGTTGATTGTATGGGACCTTGGAGACAGGCCTTTCCAGTGGACATTGATGTCTGACTT
CATGCTATCTAGGCTCCAGACAGGTATGCGGGATATTTTGGAAAGCTCTAGGGCGGTGGC
CAGGGTCCACATTGACCAAGTCATCATGTCCATCCATACTAACCTGCAGAACAAGGCACA
TGTGACTGAGACCCTATGCAAGGCCAACTTCAAGTTCCCTAGCCACCAGAAGATCCACAT
TTCTAAGGAGTGAAGCTTTATTAAGTTTAATGTGGAAGAATTTGAAGGTATGGTGCTGAA
AAGTGCCTCATCCCAGATGGGTGGGGGTCAAATACATCCCTAATCGTGGCCCCTTGGGAC
AAATGTTGGACGCTGCACTCATGAGAACTCAGCAGTGCCCCCTCTTATTCATGTCCACCA
ATAAATTCTACTTCTGTCAAAAAGAAAAAGAAAAAAAAGACTAGAAGAGCAAAATGGTTT
TCTTCCTGTCAGCTAAAAGATAAATGTTTACTGGGGTGCCTGGTTGGTTCAGTTGGTTGG
CCGGCTGACTTCAGTTCAGGTCATGATCTCGCAGTCTGTAGGTTTGAGCCCTGCATCAGG
CTCTGTGCTGGCAGCTCAGAGCCTGGAGCCTGCTTCCAATTCTGTGTCTCCCTCTCTCTC
TACCCTCCCCTGCTCGCTCTCTCTCTCTCTCAAATAATAAACATTAAAGAATTTTTTAAA
AAAAGATAAATGTTTACCAAACTATAAGTGATTATGGTCACTAAATAAACTAATACACTT
AAAAACCGGTATCACATAAGTTTTATCATCATGATTTTCATCACATTTTCACACCACACA
AATTATTAGTTTCTTGTTAGTTTTTTATTTACTTTTAAAACTAACTTACTTTTAAAAATT
ACATCCCTTTGGGGCGCCTGGGTGGCACAGTCGGTTAAGCGTCCGACTTCAGCCAGGTCA
CGATCTCGCGGTCCATGAGTTCGAGCCCCGCGTCAGGCTCTGGGCTGATGGCTCGGAGCC
TGGAGCCTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved