Felis_catus Locus Mono:134:SNORD89
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:134:SNORD89
Felis_catus
Mono:134:SNORD89
GeneScaffold_2737
SNORD89
1001..1115
2115
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGACCTGAGCCAAGTCGCTTAACCG
ACTGAGCCACTCAGGCACCCCTGGAAACATGTCTTTAATAGCAGAGAAAGGAATTACCAA
GAAAAAATAGAGAACTGCAACACTTTGAAAGCTTCCTTTGATAGGCTTTTTTTTTTAGAT
ATAAATATGATAGAAAAGGGTCAAATATTAGCAGAATGTTTGCTGAGACATGAAATTGAT
AAAATGCTACTCGGAATATGGGAATGTAATGAAGAAAGGGTAAACCAGAGAGATTTGGTT
TAAGGTTAGTCATATTTATGGCAGTAATCATGTTCCCACTAACAATTGTCATAAAAGCCA
TTTGTTCACAATTACTGTAGAAACAGTTTTTTTTTTTTTTTTTTTTTTAACTTTGAAAGT
CCCAGGCAGCATGTGAAAGAAGCAGTTTGACCATGAACGTGAAGCACTGTTGTCAGCCGC
CTGCCCAGGTGCTACTTCTGGGTTTCCCGCTAGAACACCACAAAGGGCAGGAGGAGATGT
GCAAAAACAGGGCACCTTGGACAGGTAAACTTCCTCACATGCTGAAGTCTGGGGGATCTT
GAATATAAAAAGCCTCTCCTGAGAGCTTGTCTCCTGCAGTCACTGAGGAGTGATGACAAT
AAAAGGCCGAATTGCAGTGTGCCCATCAGCAGTTTGCTCTCTGTGGGGCGCACGATGACA
AAATCTCCAGAAGCGAATCACTGGTCTGACCTCAGTAACCTCAGGATTGAAGCTTTGCAC
TTGGGCAGGCTTTCTCAGAGGGGTCTGCTCTTCCCAAAGAGAGCTGATATTTTTAGAAGA
AAAAATAATCAGTGAATTGAAGGCATTGGATCTTAAATTGAGTAGTAAATACCTGTCTAC
ATACTTTGCAGTCTACTTGCTGCATCAGGGACTGCTAGAATCAGAAACAGAAATAGGCCT
TCAAGAACAGGTGTGTTCCCACTGGGATGAAATACCCAGTGTAACCAAATTCCCCAAGAG
GATAGCTTAATTGGCAAGTTTCTTCTTTTGAGCACATTAAAGTTTATTTGCTCAGTGAAG
GCTGAGCTTAAATCAGTATGTGTATGTTATTAACGAGAACCTGAGGTAATTACATGTTTG
GTCAAAAGCAGTCTCTTTGAGCTCAGCGTAACCCAATTTGTGATTTACAAAGCACAGGAT
GCTGGCCTGAACCAAAGTGAGTCTTATATATAACATACGCTGTGCTTCTGTGATGCAACA
ACCAATTAGAAAAGCCACCTACGCCTTTCCCAGTTAATTTCGCTTTTGAAGTTTTAAAAA
CATTTCATTTTAAAAGATACTAACGTAATTCTTATAAAAGTGAAATTTCTACAGTGTAAT
CAGCCATTTAGCTAGATTTGCCTTTATTCTAACAGCAAAGTAGAAGTTGTAAATTGAAAA
AGGTATATGGATCACATTAATTCAGTCTATTTTTTTTGAAGAGGTGTAAGCATGTATATT
ATGGGCCAATGAGAAACCTGAGAACACCAGCACTTTCGTGGGGCTTGGCTGCATAGGTAT
GGATCCCAGGACTGTGTTTTTGGAAGCATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved