Felis_catus Locus Mono:119:SNORA43
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:119:SNORA43
Felis_catus
Mono:119:SNORA43
GeneScaffold_4076
SNORA43
1001..1131
2131
CCCTCCCTTCATCGTTGTTCACGGGCTTCACCGACTTTGGGATAAAATTATTTTCTGGT
GCCTACTCCAGACTAACTCTCCCTGTGGCTGCAACCCACCTGCCCACCCATCCGTCCTCG
CTCCCAGCCATGGAACTCAGTAAGCCAGACACTCATTGTACCTATCGAGACCCCAGTAGG
GGTCACGGGCTTCTTAGGCTCTGCTGTGCTGAATCAGTTCATAGGCTTGTTCAACCTACC
TATTTCCCCACTTACTACTTCTGGTCCCTGCTCTAAGAATTGCCCCCTGATGCCTGGCTG
GTTCCTTCTACCTATTGGTTTGGCCCTCCTGAGATACGAGGGTCCTTTCTGGAGCTTGCT
ATCCTTCTTTGGACACTCTTCGTTGTACCTACGCTTCTTTGAGTTATGCCCAAATAGTGA
GACGTCAAAACACAGAGCTTCCAAGAACAACTCACCTCCAATTCAAGGCTGAGAGTGTCC
TGGTCCATTTCATTTACCTGTTCACTCACTATCCTCAGCAGATTCTGTCACTTATGATTC
CCCTCTTACTCCCTTTGGGTTGACTGTATTCCTGGAGATAATTGGATATGATACGCCCTG
GGGTACAGCAAAACCAGGCCCAGAGAATGCTGACCAGGCAGTTCCTGGCTGATGCCTTGG
GGCACAGCCGAGGGCCTCCTTCCTGCCTGAGCAGTCCCGCTGGCCAGGACTTCCCTGCAT
CCCTGCCCACCATGGCATTCTCTCAGTGGAGGGAAGACTCCAGAGAGTCTTTACCAAGGA
TGCACCATTTTACCTGGGTCTTTCATTCATTTATCTTGTCAAGAAAACCTCTTGCCCACC
CACTGTGCATATGAGTCAGGGGAAAGGCAGGGCTTTGCAAAAGGCAGACACACTAGAATG
AATATTCCATCACTTCCAGTCTCAATAAACTTTTCTAAAAGTTGAGTCAATAGTACACCC
TTCACAGGTCTGCCATGTTTCTGAGCCTGGCCTCCAGGCTGGGTGGCTCAGTGGGTGAGA
ACAGCTGCTCTGCTTTGCTGCACCTGTGACACTGAGGCAAAGAGGAAGTGGCTATTTCTA
TGCTCAGTGCTCAGAAGAGTGACCACTAAGAATGATTTGTAGCCTAACAAGCCGGGAGAA
AAAACACCCTTCAGGTTAGGGTGGGGGAAAGGTTTGACTATTTTTTTTTTACCATGGAAC
TCTCATATATCCTGTTGTTTACATGACTCCGTGCATTTGTTAAAATTCATAGAGCGGTAC
ACCTCCCTCCTTCCCCACAAAATGGATTTTACAGCATGCAAATTAAAAAAATGAAAAACA
AATACACTCCATGGAGTTCTGTGATGATTAGAAACTACCCAAAATAGCTGGTGGGCTCCT
AACACCATGCCTGGCACACAGTAGGTGTGGGAGACTTCCATCCCAGGCTTGCCCAAGAAT
GTGCTCTTGAGTGCCTGTGGCTGACTTCTGGAATTTACTCCCTGCCTCCCTTTGATCAGA
AACATCCAGTTTATTGTCACAAGACCAAACATGGGGGCTCCTTACAACATCCATCCTGGT
TTGCCTTGGACCACAGGGCTCCCCAAGATGCATGACTTTTGTTTTAAAACTGGGGCCATC
CTGGGCACCTGGGTGGCTCATTCGGTTAAGCATCTGATTCTTGATCTCGGCTGAGGTTGT
GATCTCATGGTTCGTGAGTTCGAGCTCCACGTTGGGCTCTGGGCTGTCAGTGTGGAGCCT
GCTTGGGATTTTCTCTCCCTCTCTCTCTACCCCATTTGTGTTCACTCTCTTTCTCTCTCA
AAATAAATAAATAAACTTAAAAAAATTAAAAAACACCTTGGACCATCCTGGACAAACCAG
GAAAAATCGTTCACCCTAGAAACAGGTAAGAGCGAGTATTCAGGAAGTGAGAAAGAGTTG
TATGAGCTGTTCAGGAAGCCCAAGGTCTCATCTCAACTGAGGTCCATGAGTTTGGTAAAC
ACCCACACTTACTGAAGTCCAAGGTTAGCTGGTAGATGGCAAGGGCCGCCGTGGATGGCT
ATACTGGTTGTGCACAAAGCAAGAGCATCACATCTAAGGAAGCATGATACATCTGGTAGG
CATGTAAATTTCTGGATGTATTATGAACAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved