Felis_catus Locus Mono:56:SNORA65
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:56:SNORA65
Felis_catus
Mono:56:SNORA65
scaffold_201659
SNORA65
1001..1128
2128
AGGGCGTCAGGCTGTACTGCAACTTCGAGCACAGTGTAATTGTATACCTTTTTTCTATA
GTCTCCAAAAAAGGTTGGTGATGACATCGCCAAGGCAACCGGTGATTGGAAGGGTCTGAG
GATTACAGTGAAGCTGACCATTCAGAACAGACAGGCTCAGGTACTTGCTTTGAGGGGGAG
GGCAGAGGTAGCAACCCTCTGGAATCCCTGGGTGGAAGGTTTTTGCTGACATGGCCATCT
GCCACAGTGGTGAGCTGAGGGCAATTTTAAATGTGGGGAAGCCTTTTTTGAGAGCAAGGA
TCAAGAAATTGTAGATGCGGGCTCAAATACTAACTTGTCACTTGTGTGACATTGGGCAAA
TCAATCACTTCATGTCTCCTAGGGTAGGACACGTTTTAGATTGTGAAAAGTAGTTGACAA
TGTACAGCAAACCCCACCTGGCCCATGTTTTTTGAGAGCCAAGTTGCTTGGCAGTATTGA
CCTTTTTCATTGGAGGGTGGAGGAGGGCTTAATTTACATGGAGAATTTCTTCTGCAGATT
GAAGTGGTACCTTCTGCCTCCGCCCTGATTATCAAAGCCCTAAAGGAACCGCCAAGGGAC
AGAAAGAAGCAGAAAAAACAGTGAGTGGTCTTTTCCCTGGTAATCTGTGAGTGGTGGTGT
CTACCCAGTGTGATGATACTTAGCTGCATGTTTTTGCTTTAGCAGAACCTAGGGATGGCA
CAGGGATTTGCTTAGAAGCTGTTAGACAGCCAGGCACTGCCAAGAAATGCCTCACGGCTC
TCCCCCAGTCCTCTTGCCCAGGACTGGCCCTCCCTAAAAGTACATGCAGGAGGGAAATAG
GGGGAAGTACTTGACAGTGATGTCCAATAATCAGACCATTTCTGAGCTGGAAGATTCTGA
CAGCTTAACTAACCCCAGTAACTTCAGTTTGTCTTTTTTCGTGTAAAAAAAGATAGTGTC
ACCCACGCAAGGTTCGCAGAGACCTGATTTTACCCCAGCCACCCGCCACTGCACCTGATC
AGTTCTCGTGGCTGGTGCAATCCAGTGGTGAGCTGATAGTAAACCCCAGCTTAGGAAACA
GGGTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGAACAGCCTGAAAATAAAG
GTGAAGGGAGAATGTGGTCTTCTCTGGCCTTGGGTTGTGACACAGCTTTTGCTGTTTATT
TCTTCTGCAGTTAAGCACAGTGGAAACATCACTTTTGATGAGATTGTCAACATTGCCCGA
CAGATGAGGCACCGATCGTTAGCCAGGGAACTCTCTGGTAAGTGGACGGCAGGGAACCCC
CTTGTTATATGGGGTGTATTCACTGAGTGGGTAGCATTTCTCAGCTTGGAGGGATGTTAC
TCTGTAAGACCCACAGTTGGGGTGCAGGGTCTTCTGGGTTTAAAGAATGACTTGGTATCA
GTGAATATTTGGGTCGGGTGTGTTTAATCTGGGTGTCAGAACCCACGGACCCTTTGCGTT
CAGAGCCTGTATAAATAACTAAATGGAGTTCGGAGTTTTGGCTTAGAGGAGCAGGGATGT
TACTCCATAAAATAGGCTTAATTTCTCTTTATCTGATGTGAAAAAGTATTTCCCCTTGGG
TATATGAGTATTGCTGAAGCCCCTCTTAATGCCACTTTTCTTAATTACAGGAACCATTAA
AGAGATTCTGGGGACCGCCCAATCTGTGGGCTGCAATGTTGATGGCCGCCACCCTCATGA
CATCATAGATGACATCAATAGTGGTGCAGTGGAATGTCCAGCTGTAAGTGACTTCTGTTT
CTCTTGCCTAGATCAGGGTGAGAGCTGGAGGAAAGCTAAAGTAGTATTTGTGCAGGCTGC
AAAGTTTCTAGAAATGGTCAGTAATGGGTTTGGACTATTAAGAATTTCTTGTTCCACTAA
TGATAGGTTTTTCTTTTTTCTTTCCCACAGAGTTAAGATTAAGAACTACAAAGGAAACTA
TTTTAATAAAGGATCAGTTGACAACCAGTGGACCTTTTGATACAGCCTCTTCCTTGAGGG
ACCTACCCCCTTTGTGGTCAAATGGTGGCTAATGGGGTCACGGTGGCAGAACCTCTGGAA
AGTCGTTGCTTGGGTAACAAGCTCCTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved