Felis_catus Locus Mono:31:SNORA71
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:31:SNORA71
Felis_catus
Mono:31:SNORA71
scaffold_214807
SNORA71
1001..1132
2132
TCTCTCACTCTTTCTGTCTAAGGAAAAAAAGAAAAAAAAGATGTTCGACATCATCAGTC
ATCTAAGAAATGCAGATTAAAATCCCAAGGAGATACTACTACATATCTACTGAAATGGCT
AAAATTTTAAATGCTGCAATAGCACATGCTGATGTGTATTCAAGAGCAACTAACACCCTG
ATCAGAATGCAAAAAGTTACAGCCATTTTGAGAAAATTTTAGGAGAATCTTACAATGCAT
GCGGTAAGGAGGGCCACATTTCTTGTTGTCAGAGAAGGAACAGAAGTTGCAAATAAACAA
AAGGTAATGGTAAGAAGAACCCTATTGTGCTGTGTTGAAGAAGAAAGTCTCACGGTAAAC
TCATGATTTTTTGAACATGCACACAGAGGAATAGAAACAGAAATAAATATAGATTTGTGT
CTGCATGAGTTATAATAGATAAATAGACAAATATGGCTATCGATTTATCTATCTCTCCAA
GCCAAGACTACTTATAAGTCCCAGAAGCAATGAAATCCCAGTAGCAACCTAGTGCCTAGA
TCTTGGTTTTGAAATACCGTTCTATGATAAAAGAAACCAGGGTTTCTTGGACAAGTGGTT
GATTCCAGTGTTGGAACAAGGAAAATAAAAAGTAGCCTGGGAACCTTTTGTGGTGCCACA
AAGGAAGTGTTATTCAAAGAAAAGAAGAAAGAAAAAGACCTGTGAAAAGATTAAATAAGA
AAGAAAAGGCAACTGTTCTTCACAACATTCCAATTAATAAGCATGCAGGGAATAAGGGAA
ATAGGAAATCATCATTAGCACACCGCAGTAACAGGTACTTGAGCCCCTGATTCTCATGGA
AAGGCAATATTGGTTGGTATTGTCTACTTCACATTTCTTTCATGTGATTAGAGAAGTTGA
GTCCTATCTGGCTTTTGTCACAGATATTTTGAGTTTTCTGTCATGTAAATTCAATAGAAT
CCTACGAAGAGGAAGAGAAGGCTCTAAAAGTTTCATTTGACTCTTTCATTCAAAAGTGCT
CTGGGCTGCCAGCGCCCTGGTCATTGATAGTATAGGGAGAGGAACCGCTGAAAGCATTTC
CCCATGCTGGAAGAGCTCATCCTGTCCTTTCCAAACTCTGGAGCTTTCATACACATCTTT
TTTTCCACTGATTTGTGTTACTTCCTGGTACCTGGTGCTGTGTGGCTTACTGAGTGCCCT
TTGCAGAGTAGGGCCCGGCCTCAGGGTGTTTCTGTTCATGGGCCAGTGGTGGAACCACGA
TAGGAGCCCTTTTCTCCCAGGGCTCTCCCTGGGAAGCTTTCTTTGCCTCCCCATCACACC
CCTTCCCACACCCTCAGCCCCATCTCTCAACCCTGATTACACTAGACGTTGGTGATTTGC
TTGTCATGCCCCCTATGCTGTGATCTTGAGGGCAGTGCCTCCATCTTGGTGCCTGGCATG
TAGCCTTAGACAAAACAAAACAAGATGGAGGAGACCAAGGCACCACATGCCAGGCCCCGG
GGCCCTGAAGTCAGCCTTAGATCCTGAGGCTGTTGAAGTAAGTCCTAAGACCGTGAGTCA
ATGACCCTCGGGACGACTTGGGGTCCGGGTTTGCTGATATTTCTCCCCAAGTTTCTCTTG
GTGGTGTTATTGGTCACCAGAGGGGCAGAGAGTGGAAAGGGAGCCCCCACATGAAACATC
CTGAGAGCACTTCCCGCCATACACTCAGAGCATCGTGGATCAGCTCTTCACTCCACACAG
GAGTCAGAGGGAAAGCACTGGGGCTGGGGCCGGGGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTCACTTTCCCCTCTGCCTACCCATTCAAAACACCTTACAGGCTTG
CTGAAAAAAATGAACGAATGAATGAAGGAAGGAATGATATAAGTTTCATTTGAGGAACAT
CATATTCTGGCATTTCCAGCAATGCCTCAACAGCCATTTACTTAATGACTATGATGGGCA
TTTGACGTACATCAATCCCTTCAGTCCTGAGAACAAATGATATATTATTATCCCCTTTTT
GCAAATGAAAAACAAAATGTTTCTCAGAAAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved