Felis_catus Locus Mono:42:SNORA74
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:42:SNORA74
Felis_catus
Mono:42:SNORA74
scaffold_183975
SNORA74
1001..1200
2200
CATAGGAGGAACTCCTGAGGATGTTGGGAGGTGGGGGAGTTATTTATAAAAACTAGTTT
TGTTCCAACAATTGGCTTTCCCTAAAAAGAGTTCTCTTAGTTAAATGTTGAGTTCCTTGT
GTGAATACCTCAGATGTTCATTGTGAACAGCCTTTTACATATGGGGTTTTAAGAATACTA
GTGATACCTAGAGGATTTGGGGGAATGGTTAGCTTTAATGGTAATTATAGGCAAGAAAAA
GACAATAGGAAATAAAATAATTCTGGAGGTATTGAAAATAGGGTAAATAGTGAATGGCAG
GCAGCACTGTTTCCATTTCTACAGAAAAGAGGTTTTAGGAGCTGCTGTTTTAGTCAACAC
TGTTTAGTGTTCAACAGTGAAATCTTTTTCTTTTTAGGATGACTTGAAAGTAGGGCATCC
TTGGCCTTCCGGAAGAGAGTAAATTCACGGCACGTGGACGGTCTGTATGGCGTTCTCAGG
TAAATGTCCCTATTAATTCCAACACTGACTACTGCCTATGTGGCAGGCCTATTTGCTAGT
TGGTATCCATTAGGAAACAACTGGGAGGCAAAATCACCTGTATTTGCCCCTGACAAATTC
GGCCTCTTAGCAGTGAAAGGCTAAGTGGGATTTTGGTGGTTCTAGTCTGAAGGTGTATAG
GATCTTTGAGATGATCTGTATCGTTCCATCTGAGGAATGTACAAGCAGATTATAAAGCCC
AGGATAGGAAGGATGGCATATCTTGCCTGTTCGCAGCTAGATCCCAATCATGGCACCTGG
CACAGAGCTGGAACTCCTTGAATGTTGGACAAAATGACTAAAAGCATGGGAAAGGGGTTC
CTGTTTCCTATTTGTCTAAAAGGCTTGGCAGCAAGGTCTGCTATCAGTGCTTCCAGGCTT
CTATTTTGCAGTCAACGTTGAATTCATTGGGATACCTGAATTCATAACTTCTACTTGGGG
TACCTGGGTATCTGAAACAAAGAAAGCTGTTTCAGGAATCACCCAGCGGTTGTCAGCTAT
CCAGGCCAGCATGATGCCTTGGATGGTGTTACACTGTTGGAAGAGCAAACGCTGACCTTC
TTGAGGTCTGGCTTCAAGCACTGTTTTGGTGTTGTGGCTGATACTCTTGGGCAGTGTTTT
GCACCTCTGAGAGTGGAGTAACTCCTCCTGTGGAGTTGGTCCTAGTCTGGGTGCAAACAA
TTTTTTTTTCTTTGAGGAAAGGACCCTGTCTTAAGGATACTTTATCATTCCTTTCCTCTT
TGAATCCTAGATGCCTTTATCTGAGTGAGAAATCTGCCTCCATCAGAATCTCAGATGTCT
GACAGCCCTGTGTGACACCAGGATAGGTAATATATACAGTCCTTTGTCANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved