Felis_catus Locus Mono:110:SNORD73
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:110:SNORD73
Felis_catus
Mono:110:SNORD73
GeneScaffold_996
SNORD73
1001..1077
2077
AGTTAGGGTTTTTGTAACGTACCATAAATTTTCTGATTTCTCAGTTCAATTTTATGCAT
GAACATTTCTTCGTTGTCTTGACTTTATGTGGTTCCTAACGTTAATGATACGACAATTTT
TGTTTTATAGAAATCGCATCTGATGGCCTTAAGGGTCGTGTGTTTGAAGTAAGCCTGGCT
GATTTGCAGAATGATGAAGTTGCATTTAGGAAATTCAAGCTAATTACTGAAGATGTTCAG
GGCAAAAACTGCCTGACTAATTTCCATGGCATGGATCTTACCCGGGACAAAATGTGCTCC
ATGGTCAAAAAATGGCAGGTGAGAACAAAAATTCCTCAGAGTGCTTGGTGCTGTGGTATG
CGTGGCCAAGGATGTGATGTTATAATGACTATGAAATTGAAGTAAGTTTCATTTTAAATT
CTTGATGTTTTCTTGTCTTTACTGAGTTCTGACTCTGGAAGTGGCACTCCTGAATTTGAG
CAAAGCTGTGAGCAAGCCATCTTCTTGTTTAAATGGAGTTCAAGATTTATTCTCAAGGTT
TAGTACTGGGTTATCAGAGTTAGTTTTTCTGCTGCGTGGATTGTTGGTTGGGGTATGTCT
AGGTGCAGGTTTTCAATTTTGTCTGTCTTTGGCATATCTTTGAAACTCAAAATCTAGTGA
ATTTTATAGTGAAAAGGTTCATTGGTGCATTTGTTTCTCTTGTAATGTAGCATGATAAGA
GTGGCAGAGCCTCTGGTGTGAGGTTGGAGTCTTTGCTCCATTTCCCAGCTGTGTTGTCTT
TGGCAAGCAACTTAAAGCTTTGCCAAACCTTGATTTCTTTATCTAAAATGTAGGTAAGAG
TATCACTTCTTGGAGTTAAGGTGAAATAAAAGCCACTGAAACATGCTTAAGCAAAGAGCT
TGACACAAACCATCTGGTCAGTATTGTTATTACAGGAAATAACTACGTTGGTTCAGATGT
GTCTGGCTAACCATTCAGTTTTGGGACATTTTGTTTATGGGAATGAATGATGACAAAATG
TTTTGGTCCCAAATGATACTGATATACTGATTATACTGTTAGGTTTATTTCTGACATTCC
CCAAGGATTTTATGGTTGAATTTCTGGAGATAGTTTAAGGTATTTTTGCTAGAAGTGTAT
TATTAAACTAATTTACAAATTGCAAGGAGGTAATTCAATTTTTGTTGCTACCTAAGGTAG
TTTTCGTTTTTTAACTTTGTGGAGTGATATGAATAGTTAACGGATTTTTAATTACATTTT
AGTTGTGAAATTGAATATCTAATCCTCAGCATGGCTCTAGTTTGGGACAGGAAGGACATT
TAAAAATACAGATATTTAGTGTTAATATTTAACCTATTCAAACACATTTTTTTAAAAAGG
AGGAGTAAGTGTAGATGTCCATATTGTAGAGTGTCTTCAAACCTATTTTCTCATCTTTCT
CATCTTCTCATCTTGTTCCACTGGGTGGGAAGGGTAGGCTGTTAAAAGGCTGGCATTGCA
TACATAAAAGGTATGGGAGTGCTGGGTGCTGTTGAGATGGGGATAGAAGTGTTACATGGG
GATGAGAAGGAGAGTTGGGAGGACTCAGTATTTAATTAGATACGAAGGATAGTAACATTT
GGAGTAACTGTTAGTAAGTTTACTTCAGGGAAGTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved