Felis_catus Locus Mono:48:SNORA70
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:48:SNORA70
Felis_catus
Mono:48:SNORA70
scaffold_190280
SNORA70
1001..1129
2129
CATCTGTTTACAACTTACTTATGTTGATTAGGTTTTTTTCTCTTACTTAAACTTTTGAA
AATTTGACTCATATCTCCAAAAATTCTATTTTGTTATTTCTGCATCCATGATATCTTGGG
GTTTTTGTTTGTGTTTGTTTTATTTTGTGTCTTCCTTTTCCTTTTTTAGTCAACATCTGT
TATTTTCTGCCTTGCACCTCTCCCTTCTAAAAACACATTACTCCTTCATGTATCGTATAG
AAAATTCTTCTTCTTTCACTGTAATTTCTTCATTCAAAGAGGAGATGTTACATTGCAACA
GAACCCATACCACAGACAGTAGCTGATCAACCCAGAGTTATTGAAGAGGTGTCTGCAAAA
ATTTTCATTCTTGGCTTACTTTCTCTGACACTAGTGTCAATGAATTATGCAACATTTTTC
CAGAATTATGTGCATATCAAATAGAAGTTATTTTTCCTGAAGAACATCAGAAAATGTACA
GGGCATTTCTATGACTATAGGCAGCCCACAGTCCATAGTAAATGGGCTCAATTTGGAATT
TTACAGGTAAAAGATATTAACTAACCTTAAAAACTGCTCTAAAACTTTTGTATATAAAAC
CTTGGACATGTATTTCAGTGAATTTGTTTTAGATGGTTTCTAGTCCTGACATCTTTCTTC
CCAACTGGATTATACCTGCCTTGAATGAGGAATTAGAACACCACTGCACAAGGCTCTCAG
TGGCTTTAAAAAAAATGACATACTTTCTTTGTTAAATTATAATTATATTTTGAATTTGAA
TGCTTTAATATATTAAAAGGAATAATTTGCATTTTCTAAATGAAAGAATATTATGATATT
ATCTGATGCATCACAATTCTCAATAGTTTAAAAAGATAAATAATTCATCATAACATTAAA
AAAATAAGGTTAGAACTCAGAAAAAGAATTTTTAAAGTATAGCAGTAGTGCATTTACTAC
TAAGTCAAGAACTTAAAGATAAGCTATTAAGAATATACAATCTGCAGCCAATTAAACTGT
GCTCTTTCCCCATGGGGGCCCAGTGTGCAATGGCTGCAAACAGCAGCCTCCTTGGTAGTG
TATGCAGTCTATTGATTGTCTGGTTGCCCTAAGGGACCTTGGAAACAGCCCTTTCCAGTG
GACATTGATGTTTGACCTCATGATATCTCCAATCTAGGCTCCAGACAGGTACATGGGGTG
CCTTTGGAAAGCTCCAGGGCACAATGGCCAGGGTCCACATGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCTATCAGTTTAGCGCTGTTAAAAATCTTACTTGCAAGAA
ATCTAATTTCTGCTTTTAATGACTTGCCTTTTAGATTGGTGGAGAGTTTGAGCGGCCAGC
CTCTGAGGAAGAAATTGCTGACACTGTTGGAAAAATGACTCTGGAGCATTGACAGGAAGA
CAATGGTATGTGTCACATCTGAAGGTGGAGGTCTCTTGTGTGTGACAAAAGTGACTAGCA
GTAGTCTGTCCAATTGGGATATGGAATATGCTCTTTACTTGTCTATAACTTGTAAGTTAA
ACTCTACATCAAATCAGATAACCAAAAAAACTCTCAGCCTGACTATACGTCTTTATTTCC
TGCAGCAACATCTTCATGGAGATACAACACAATATATGATTGTACTATCAACTATTGTCA
AGTATTGATTTTAGAAAAACACACTATTTAAAAATTTTTGTATATTTATTGGTATAACTA
CATAAGTAGTACCAGTTTTGTTTTGCATTGCACTCATAGAAAGACAAGCATGATAAATTT
AGTGCCATAAAAATAAGATAATTCTCCCAAGAAAATCTTATGATTCCCCTTATTAGGGGA
GAGCTCATTTATACCAGTGTTCTATTAGCCCAGGTTTTTGGGTTTTTTTTAATTAATTAA
TTAATTTTTAAATGTTTGTTTATTTTTGAGAGCGAGAGAGCACAAGCAGGGGAGGGGCAG
AGAGTGACAGAAGATCCAAAGCAGGCTCTGATCTGTCAGCACAAAGCTCCATGTGGGGCT
TGAACCCACGAATCGTGACATCATGACCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved