Felis_catus Locus Mono:131:SNORA18
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:131:SNORA18
Felis_catus
Mono:131:SNORA18
GeneScaffold_3491
SNORA18
1001..1123
2123
NNNNNNNNTTTTTTCAAATGACTGCTGAGTTATTAAAATACAAGTACCTCTTATATTGT
TTGGACTTAACTATTAAATGAAACTGTTAGGCATTTAAAACAATTTTTTTAAGGACGCTT
CACACCCAACGTGGGACTTGAACTCACCACCTTGAGATCCAGAGTCGCACGCTCCACCAA
CTGAGCCAGCCAGGTGCTCCTGTTAGAGGTTTTTTTTTTTTTTTTTTTTTTTTTGTCGTT
GTTGTTGTTTTGTTTTGGTTTTTGTTTCGGCCCCGGGTGTCATGAAAATCTCACTGAGGT
ACTCAGATACCGTGAACCCAGGGAGTTTAAGAGCCTCTGCCATGGGAATTTGATGGGTTT
GGGACTTCAGTGTTTGCCGATTCAGCTCTCCTGTGATCAGTTTCTGGACCCTGTGTTCAG
GGCTCTCTGGTGCGAGCCGAGGCAGACGGTGCTTCTTGTAGCAGGTTCGTGCAACCACCC
TGAACTTGCTCACTGGCTTCCAGCAGGAAGCCTTGACGCTCCCCATAAAGAGTCCTTTTT
CTCTCTGCCACATTAGTGTGGCTCTGGTTGACACTTTAGAATGCCCCTTTTTCCAGATGA
GGAGCCAAACATCGAGCCACCAGAGACCCTGCCTCAGGTTCCCCAGCCCTCGCGTAGTGA
AGCTGGAATCAAAGCAAGGCTGCCTGGTGCAGGGTGACTGCCCTCAGCGACTACTAGCTG
ACTCCCAGGAAGAACTAAATCCCCGAACTCACCAAAACCATGCTAAAGCATGGCCACCAC
CAGATGCCCTAAAACTGCACCACGACCTGACTCCGCCCCTCTTATCTGCATCCCACAAGG
TCACAGACCTCAGAATCCTCTTCCAGAATCACAGCTGACCCTTCCGGGGTTAGGAAGACG
TCACGAATCCCACCCCGCCCCCCACTACTGCCCCCAAATCACAGCACAATCAGCCCAAGA
GGTTACACCTTGCAGCTTCTGGCTGAAAGCAAGTTCCCTCTGTCAAGGTCAATCCCGATG
GGGCTTTTTCTGTAGACCTGCATCGTTGGGAACACCTCAGAGATATATGTGTGGTTTTCT
TTATTCACAGAACTAGATTTCTGAAGTATGTCCGTATTCAAGTGGAGATCAAAGAAGCCC
ACCCGAAAGAATTGTGGACTGACAGTGAACTGTGGATTGAACAAAAGTTCTCCTTGAAAG
GGCTGTTTTGAAGATTCCGATTCTGACTTTGGAGGAGCTAAGATGATTGGCAGTGGAAGG
AATCACGTAGAATGCCCTAAGTAAAAACGTATTGACTTAAAAAAAAAAAGCAAGTCCCCT
GAGAGGTGGAAATTTTCTAATCAGAGACACGGCTGTCACTGTGGTCTGGCTCAGCTCCAG
GGGTGAAGATCACAGAATCTCCTGGGGTTCAAACCTCCACTTACTAACTTGGTCAAATGG
GGCGGTGGCTTAACACGAGGCACACAGGCTGAAGTGCCTTCGGCCCCCTCGTCCGTCAAT
CACGGTGAGAATGGCACTCACTGCATGGGGGTTGTTACGGGCCTCAAATGGGTGAAGACA
TTTAAAGCCCTTAGAATAGGACTAGGCATATAATAGCTGCTGCAAGCTCTCATTATTATT
TTCACTATGATTTGCCACCAAACGTTACTCCCATTCATAGCGGCCAGGGCACTGCGTTGG
GATCTCATCTGGAAAGCATCTTATTCTCCAGGCTTTGGGTTGGTTGGGGGGTCGCTCCAC
CAAATGCCTAACGCAGGCTGTCTAGCTGGGTGTTGGTACCTACTGGAATCCGGTAGGTGT
TAGTTCTGCCCCTCTTTAACCGCAGCTCCCCAGTCTGTCCCAACAACCTTTGAAAAACAG
TTCATTGAGCCCCTGGCACTGACTCCTGGAGCCCCGGTCTAGTGCGGGAGTGAGCAAGGG
AATATTTTCAAATGTAGTGATGAGCGCTGAGATCAATCCTGCTCCAAAAACTGTGACTCT
CAGCTTCTACATGAGGGTCTCTGAGCCCGAACCCACTCCCTCCTGCCAAATGCACACCCC
TGAGGAACGTGTCCACAGTTTGGAGGGCTAGCTGGGGGAGGGGAGCACCCAACATTAACA
ATTTAGGTGACAGTTTGTGCTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved