Felis_catus Locus Mono:90:SNORD16
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:90:SNORD16
Felis_catus
Mono:90:SNORD16
GeneScaffold_3138
SNORD16
1001..1099
2099
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTGCAATGATGTCGTAATTT
GCGTCTTACTCTGTTCTCGGCGACAGTTGCCTGCTGTCAGTAAGCTGGTTCAGAAGGGTG
ACGAAAATTCTTACTGAGCAAGACATGATCTTTTTTTTTTAATTGCCAAAATTTTGAGAA
ATGAGATTCTTAACTGGGAAAATAGATGTGTCGTGGGGGCCGCATGTTCGCACCAACGAA
AACTTGGCGCCGTTGGCACCGCAGAGTGAACACAACACAGAAGCGATACGCCATCTGCTC
TGCCCTGGCTGCCTCAGCCTTACCAGCACTGGTCATGTCTAAAGGTTTGTAGATTTTGTT
TCATAGGACTGGTACAAAGTACCCTTCCCCCCCCCCCCAACCATTTCAATCATGTTAATG
ATCTGTTTCAATTCTGTTCATCCCAGAGTGCCTGACTAGATTTCCCTCTTCTGAATAATA
GTTCTGACCACTTAGGTCGATAGTAAGTCAGCAGTGAAGACTGTGTAACTGGGAAAGTAA
TAGAAATACAGGGATTTCATATGTTGGCAAACTTTTCCACTCGGTTCATCACGTTCCTAC
TCTGTAACTGTCAAAATGATGAGATTCCACTTAATTGGTCCGTGTTTCTGAAACACATGA
TATTTGTGGAAATTCTGACTTGGCACATTGTATTCCATTTTGCTTTTGTGGATTATATGA
AATGTTTCTCTATTTTTCAAAAGGTTCGGGGTAAATGGTTTTTGTTAATTGGCTCTGTCA
GGTCATCGTATTGAGGAAGTTCCGGAACTTCCTTTGGTGGTTGAAGATAAAGTTGAAGGC
TACAAGAAGACCAAGGAGGCTGTTTTGCTTCTTAAGAAACTTAAAGCCTGGAATGATATC
AAAAAGGTAGGCTTAATGAACAAATTTCCTGTTTGGTGGTCCTTAATTTCATCAGATTTT
AAATTTCAAAAGATGACTGGAGGATAGATAGTATAACTTGAGGGGCTATGAGAACGAGGA
TTCTTAAAATCTTATAAAACTTAGGTTTGAATCTTGCCTGGCATTTACGGTTGCGTGTGA
ATGTTGGGCAATTCATCGTGGCTCCTTTCTTTACAGTGGAGACTGATTTCTTGAAATCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved