Felis_catus Locus Poly:14:SNORD115
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:14:SNORD115
Felis_catus
Poly:14:SNORD115
scaffold_95913
SNORD115, SNORD115
1001..1081, 2257..2337
3337
TTTGGCATAACGGGTAGGTGATGCCCAAAAAATTCAGGTAGCGTGGCCCAGACCCCGAG
TGGCATGTGGGCTCCTGCCTCCGTGTTCTTCACTGTTGGCACCTTCTGGTGGTTGCATGT
CCTTATGGGCCCGAGTCGTCCCGCAGCTGTATGGGGCTTTGTCTGACAATGGCCCTTTAG
TCGGTGCCATGAGGCTGGGCACGCTGAGGTTCTTGACTTGTGACCCTGAGTCTCAGTGTG
TTTGAGGGTGCTGGAGAACCGTGCTGGCCTCTCACCCTTCCCTCACCGTAATCTCAAACA
CGGGAAGGGATGAGGTATCCCCACAGGAGCCATGGAGCAGTGGTGATGGAGACAGTGTTG
GATGATGGTTGGGTGCCCATCAGGGCCATGTTCCCCCAAGGGATCTTGGTGTTGTGTCTG
CATGGTAGCATTCATGGGCCCTTCTGGGGCCCCATGCCTGCCCATTCCTGGCAAAATGCA
GGGCTGCCTCCCTGCCAGCCAAGGCCCGGGATTCTGCCTGCCACCGACCTGCCAAAGTCT
GTCCCAATCATGCTGCAGGAAGACCTGTGCATGTGGCCTGGTGCATGATGTGGCAGCCTC
CATGCTCAGACGCCAGTGGGTCTTGAATTTCCTTGTTTCCTGTGGAGCCACAGAGGCTAA
GGGCCTTGTGGACACACTGCAGCCTTCCTTCCCGCCAGGCCAGGATTGCAGGATTGCATC
ATGAATGCAGTTCCAGCCCTGTGCATTCTGAGATCCCTCCCATTGCCACAAGGTGACGTC
TGATGGGAAAGGTGTTTGTCATTGCTGAGCTGCCTCTCTCTGTGCAGATCCTGCGCCCCG
TTCGATATCCCACCTGGTGCACGGAGGGGAGTTTGGCCTATCTTCGGGAATTGGCCCCAA
GCCAGGGGCCCTAATGGCCACCCTGCACATCACAATCCCTCTCTGGTAAGCATGTTGAGC
AGGCAGGTAGAACACAGAGGCGTGTGGGGACTGCCTTGGTTGGGTCAATGATGAGAACTC
ATATGGTCTCAAAGACAGATGATGACCTAAAAATTATGCTCAATAGGATTACACTGAGGC
CCAGTGGGGGGCGCCAAACAGAGGCGGTATCCTAGGGACCCCTGTGGCCCTGGCGTAACA
CTGACACCTGGGGCTCGAGGCCACTGATCCCTCGAGGCTCCCCATTGGGACTCTTCCCAG
TCTCTGGGCCTCCTTGTGTCTAAGATGTGCTCCCGCCCTGGGGCATTGTGTGCCCATTAC
TAGTGCTTCCCGGGACTCATCCCTGGGAACCCAACTAAGCTCCCTTGGTGTCCCAGTGTC
TTTCAGTGGGACGTCGTCTTGGTGACCAGGGTCTCGCCATTGGGTCCTCTGTGGTAGGAG
AGTGGATGCCTGTGTGAGTACCCAGAGATATAGTGTCCTTGGGCAGATTGTCGAAGGAGC
CCTCAGGACAATGCCAGCCATCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCTGGTGGGATACCCATCAGGGACTTGTTCCCCAAGGGATCTTGCTATT
GTGTCTGCGTGACAGCATTTCTGGGGCCCCATGCACACCCATTCCTGGCAAAACTCAGGG
CTGGTCCCTGCCACCCAAAGCCTGGATTCTGCCTACCACCAACCTGCCAAGGTCTGTCCC
AATCACGCTGCAGGAAGACATGTGTGTGTGGCCTGGTGCCTGCTGTGGCAGCCTCCATGC
TCAGATGCCTATGGTGCTTGAATTCCCTTGTTTCCAGTGGAGCCTCAGAGGCTAAGGGCC
TTGTGGATATGCTGCTGTCTTCCTTCCCACCAGGCCAGGAATGCAGGATTGTGTCATGAA
TGCAGTCCCAGCCCCACGCATTCTGAGATCCCTCCCATTGCCACAAGGTGAGGTCAGAAG
GGGAAGGAGTTTTGTCATTGCTGAGCTGCCTCTCTCCACGCAGATACTGTGCCCCCACCG
AGATCCCACCTGGTGCATGGAGGGACATTTGGCCCACCGTCGAGAACAAGCCTCAAGCCA
GGGGCCCCCATAGCCATGCCACACATCAAAAAACTTCTCTGGTAAGCATGTTTAGCTGGC
GTGTAGAAGGCAGAGGCGGGTGGAGACTGCCTTGGTTGGGTCAATGATGAGAACTCATAT
GGTCTCGAAGACAGATGATGACCTAAAAATTATGCTCAATAGGATTATGCTGAGGACCAG
TGGAAGGCATGGCACTGAGGCGGGATCCTGGGGACCCCTTTGGGCCTTGTGGAGCACTGG
CACCTGGGGCTCGAGGCAACAGATCCCTCAAGCCTCCCCAGTGGGGCTCTCCCCGGTTTC
TGGGCCTCTGCACGCATAAGACGTGCTCCCACCCTGGGGAGCTGCGTGCTCATTACTAGT
ACTTCCCAGGACTCATCCCTGGGAACCTAAACTCCCTTGGTGTCCTGGTGTCTTTCAGTG
GGATGTCGTCTTGGTGACCGTGGTCTTGCTATTGAGCTGACCAAGGGAGGAGAGTGGATG
CCTATGTCAGACCCCAGAGACCCGCTGACCTTTGGCCTACAGGCGAGGCAGCCCTCAGGG
AAACTCCAGCCATCTTGTGGGACTGGGGCTTCGTCCTCGCCCCAGAGGGCAGGTGTGTCC
CTGAAAGTCTGACCTGTACACTTGGTTGTCTGGAAAAAACAGGTCACCCGCGACACTTGT
AAGGGATGCCATGGTCCCCCATGGGATCCTCTTACTTGACGGACCATGGGACACGTTTCC
CAGTGTGGGAGGGCATTCCAGTTGATGTCAGAATCACTGATGCCTTAGTAAGCACACAAC
ATGCTGCAGTGGGCATTGCAGACGAACAGTGTGACCACCTGCATGGAAGCGGTGCTCCCA
AATTTCACAAATGGGATTTGGAGGCAGGGGCCTGGCGGGGGTTACCTGGATGGAGACTAG
ACAGCTTTGGCACAACGGGTAGACGGTATCCGAAAAATGCTGGCAATGTGGCCCAGACCC
CGAGTTGTATACAGGCTCCTGCCGCCAGGTTCTTCACCATTGGCACCGTCTGGTTCTCAC
GTGTCCTTATGGGCCCCCGGGGTCGTCCCACAGCTGTATGGGGTTTTGTCTGACAATGGC
CCTTTGGTTGGTGCCACGAGCCAGGGCAGGCCTGGGTTCTTGACTTGTAACCCTGAGACC
TAGTGAGTTTGAAAGCACTGGGGAACTGTGCTTGCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved