Felis_catus Locus Mono:93:SNORA51
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:93:SNORA51
Felis_catus
Mono:93:SNORA51
GeneScaffold_132
SNORA51
1001..1130
2130
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGTTCTGTGTGATGTTATTCT
GGTTAGACGGTGATGTGGAATAGAGAGAGCACAGCATATGGTACATTCTTTTTATTCTCA
ATCTGTATCTGACATGAGGAAAATAGCAAACTTGGGTGAAAGGTATGTTTATTTTTGAGG
AATAATCTGACTACCTTAAGGCTTCAGTTTGACCAAAAGGCATGCCTTAATTGTGAAATA
AATTTAACTTTATTTACTTATTTACTTACTTATCTTAAGCTCCATGTCCAATATGGGGTT
GGAACTCACAACCCTCAGGTCAAGAATCACATGTTCTACGGAATGAGCCAGCCAAGTGCT
TCTAAATTTAACTTTAACCATGGAGTCCTTAAATGTTAAATATTGTTAATAACTTTGTGA
GTGCTCAGATTTCCTCTATCAGAAGACTCAGAACTTGGAAATTGGAATGAACTCAAACCC
ACCAAGAATTTTCAGAGCATTGTTTGAAATTTAAATATCTTGGTGTTTCAGGGAAAAGGA
ATGTTTTGGGATTTGGAGGCCATCAATGGTATATTGTCCACCATTAGACTTCACCATTCC
TGGTTTTAGCAACTACTAGTCTCAAAATAATGTCAATTTTGAGCCTCCTGGTGCTTACCA
CAGGCTGTGTTCTTATACTGACTGTACAGAAAGAGGAGGCAGAGTAAATCCACCCATATA
CACCCCAGCCCAGTGCTTTGCCTCGTCTGTGTTGGGAATGGGGGGACATGGAGGTGAGGT
TTTGAATCTGACTTGTTCCCTATTCTCCAGGCAAAGAATAGAAATGGAGAGGGCTGAGGC
TGTAGCTTTGAGATATAGCAACTGGGCAGGGAGGGATTGTGGCTGGCTCTTCAAAAAAAA
AAAAAAAATAATACCAATTTTAAGGGCATAAGTGACACAGAACCCAGATAGCAAATTAAT
CATAGCTGTTCATTTTTAGTGATACTTTTATCAAAAGTTCTTCAAAAAAGGTTGCTCTGT
TTCCACCATTTTTTCAATCAAACATAAATCTTTACGTGTTAACTGTGCCCAAGGCATTGT
GCTTGGCACTGGGGATAGGAAGTAAGAAAGAGATGAGACAGGGACGCTCCCATCAAAGAG
GTGACTATATGGAAGGGGAATTTAGCCATGGACACAACTAAAAACAATGTAGAAAATGCC
TTACCTGTAGTAAGGACTCAGCAGTTGCTGAATTGAATTAATATCAGAAGAGATAAATAA
GTACTAGCGTAGCTCAGTGGAAGGAAAAGAGAGAGGTTAAATTTCCAGAGAAGTTGTTTC
TCTGAGGTACATAAGAAGTTTCCCTGGTAGTCACATCTGGCAAGAATGTGATTAGTGAAG
GGCCACAATCAATGTTTTGTCTCAAGGCTGGGGTTCTCTCCAGCCTTAGACACATGAACA
ATTGGCTTTTTCAAGTAAATTTTTCAACAATTGATGCAGGGAAAAGAGTTTTTATATGAT
CCAGGTATGTAATCATTTTAATGAGAATTAAAAAAAAAAATACCAGTGAGTTGAGATCTT
AGGCTTTAGCATAAGAAGCAACCATAAGATTAAACTAATGTGGAGGGGCTTGATAGGATG
TGGGGTTAGTTCATAGATTCCTTTCTTCAAAATGAAGAGAGATAGTTCAGTATGTGAAAC
ATTTAAACAGAACTTTTCTGGAGAGACAAAGAGAGGGAATGAGAGAGAGAAAACGTGAGA
GTGAGAGCAAGCATGATCTAAGCTAATCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved