Felis_catus Locus Mono:133:SNORA33
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:133:SNORA33
Felis_catus
Mono:133:SNORA33
GeneScaffold_395
SNORA33
1001..1130
2130
CATTGGAGTCCCCGAAGAAAGAGCAAAGAGTACAGAGCCAGAAAACCATTCAAAGAAAT
ATGGCTGAAGGCATCCCAAATTTGGCAAAAGACATAAACCTACCCATTCAAGAAGTTGAG
CCAACACCCACCCTGATAAACCCAAAGAAACCCACACCACAACACATCCTGATCAAACTT
CAGAAAACTAAAGACCAAGGAAAATCTTGAAGCAGTGAGAAAGGACATGTAACCTATGGG
AGCAGCCAGCTTGAGTGGCAGTGGATTTCTCTTCAGAAATCAGGGAGGCTGAAAGGAAGT
GACCCATTTTTTCAAGCGCTAAAAGCAAAGAACAGTTAGCTTTAAATTATTAATCCGGCA
AAATTCCTTCCAGAAGGAACGGGAAGTAAAATACTCTAAGGTGAAGAAAAGCTAAAAGAA
TTTTATACCAGCAGATCTTAAAAGACTGGCCAAAGGAAGTTCTTGAAACAGAAGGGAAAT
GATAAAAAAAGGAATCTTGGAAGATCAGAAAGGAAAAAGGAACAGCATCAGGAGCAAATA
GTGAGTAAATGCAATAGAGTTTTCTTCTCTCTTGAGTTTTCTAAATTATGTTTGATGGCC
AAACCAAAAGGTGTAACACTGCCGGATATAGATTTCAATGTGTCTAGAGGAAATCCTTAA
GATAATTCTATTAGAAACAGGGGAGGCAAAGGGACCGAAAGGGAGGAAGTTTTCTATATT
TCACTCAAGGTGGCAAAATGTGGACACCAACAGATCTTTGTGGTGATGGAATGGTTCTGT
GCCTCAACTTCAGAAACGATTGTGTGAATCTACACGTGTAACAAGATGGTATACAACTGC
GCATACACATCATACCGATGTCCGTTCTCTGCTTGCGATAGGCACCATAATTATACAAGA
TTCAACTACTGGAAACATTGAAGGAAGAGCATATGAGACTTCTGTGTGCTATCTTCGCAA
CCTCCAATAAATCTATAGTTGTTTCAATATATAAAATTCTTAAGCCGGCCAATGAATCTT
TTTACCTGAATGTGTTTCTGCAGAACTTTAAAAAACGCTGGCAAAAGTAATGCCATGTTA
CGAGCCTTAAAGACACTGAAGTCATTAAGATCCCTGGAAATGACTACAAGAAAAAAAATA
AATGATTAAAAAAGATAAAAAGTTCTTTAAAAAAAAAAGAAAGAAAAAAATGAAGGTGAA
ATGAACAAAATTTTCAGACAAACAAAAGCGAAGTGATTTTGTCACCAGCTTACTAGCTTA
GTATACAAGAAATACTAAGCAAGTTTTTTTAGAACAAATGGAAATAGTCCCAGAGGGAGG
CACAGAATTATGGAAAAGAATGAGGAATATGAGGAGTAAGTGGTTAAATATATATTTACA
TTATTTTTATGAATATATGTTAACCGTTTAAAACTTATAAAAGAGAAGTAAAAATATGTG
AAAACGTCAGCATACAGGGCAGAAGGGGAAAATTGTAGCAAAGCTTTTCTAACATTCTTG
CACTGTCTGGGAAGTGATAAAAGTGTGAATTTAAGGGAGACTGTAGCAAATCAGAAATGC
ATATTGAAATCTCTAGCCTATAAAACCACTAAAGTGATACAAAAATGCCTACCTAAAGAT
CTAACAGGTCAAATGCACTAATACTTGATTATTCTCAAATAAAGTAGGAAAGGTCGGTTA
AGGAAAAAGAAACAGAATGGAACATATAGAAAACATGGTAGGATGGAAGACTTAAAGCTA
ACCATAAGTTCATTTTATTGAATGTAATGGAATAAACACTCCAATTAAAAGACAAAAATG
TCAGGCTTGGTAAAAATCAAGACCCACTGTGTGCTGTTGACCAGGTGGACACTCCACGCA
GAGGAATGGCTGAAGGGCACAGAAAGGTTGAAAGTGAGAGGATGGAAGTAGATGCCATCA
TCACCCAATAAATCTGTCTTCCACTTTGTCTAATCTTTTGTTAAATCTTTCTAGTGAGTC
CTTTTATTTCAGATACTGTCTTTTTCGGCTCTAGAATTCCTGTTGGATTATTTTTAATGG
ATTCCAGTTCTCTTTTGAAATTCTCCACCTTTTTATGCATTTTCTTGATCTTTTTCCTGT
TGCCTTAAGCACGTTGATGATGGTTACTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved