Felis_catus Locus Mono:124:SNORA42
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:124:SNORA42
Felis_catus
Mono:124:SNORA42
GeneScaffold_130
SNORA42
1001..1139
2139
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAGGGCTGGCAAGGTCAGGCTCTTCATGA
TTGGCGGGTTTTCTATACAGAAAAGACAAGACCTCAGTTATGGAAGGAGTCCTGTGCATC
AGGTCTAGCCAGATTTCCCATCCACAGCCCCTCCATTCCTGACTTCCTGGCAGGGGGCTT
CTGGAGTTTTGGGGGATTTAGGGCAGAGGCTGTACATAGGAAACTAACAACCTCATGGCC
AGACAGCCAGCTGGCACACAGGGCTTCAGGAGGTAACCTATATTTCTTGCACTTTTCAGA
GAGGGACCATACATTCATTCATTCATGCGACAAACATTTATTGAACACTTCCTGCCTAGT
ACTCTGGCCAGGTGGGAATTTTATGTCCAACCATAGAGGTAGCCTTGCTCAGCTAGAACA
AGGCGGAGACTGTTCCTGCTCTCTGCAGCTGTACAACACACACTCCAAGGCAATTTAACG
TGGGAGCCTATACTTTCCCTAGATCACTAAGGTTTATTTATATCTCTGCAGTAAAAAGGT
ATTTTATAGCCTATATTATTCCCTAAAAGATAGGTGGCTTTTTACTCACTACTCAGTGGT
CTTAAGTGCATGCAAGCTAATCTTTTCTTTCTGTGTTTTGTTTGTTTTTGGTTTGGTGTT
TTTTGGTTTTTTGTTTTTTGTTTTTTAAGAAATGGAAGTCATAATGAGAGATCGATGGTG
TCCAGAGTCATCTCTTTTCCCCAAGTCATTGGTTCTCAACTTGGGGCAATTTTGCCATTC
CCACCCCACTTCCCCAGGGACATTTGGCAATGTCTAAAAACATTTTTGGTTGCCATAAGC
ATGTGTAGGAGTACTACTGGCATCTAGTGGGTAGAGGCCAAGGATGGCATCCTACAGTGC
ACAGCACAGCCCCACAACAAGAACTCTCCAGCACCAGTGCATGGTGATGCATTGACGGCA
GGCCCTTATCTGTGGGCCTCTCATAGTGTACACATGCCAGAGGAGTGTGCAACCCCAAAC
CATTGTCCAGCCTCCTCACTGGTGGCCTGGCCTGTGAGCACTGAAGGGTGCTGTCTAATG
TGGGAACAAAAAAAAAAAAAAAAAAAGAAAGAAAAACAAACAAACATAAAACAAACAACG
AACTATCCAGCACCAATTGTCAACAGTGCCAAGATTGAGAAATCTTGGTCTAAGTAAAAA
AAGCAGAGATCTAAGTTGGCCTCTATTTAGCCTTTGGCAACCCTGCCAGTTTTCTATAAC
TTCAGAAGGTGTGAAGAGACTCAAAGATAACTTGCACCAACTGAAACTAAGCAATCTTTT
TTGGTATAAGACTCACATAATTTTCATAAAGCACCTTGACAGCACTCTTTCTCATTGCAG
AACATGACACTCTCTGAGTGGAGGGAAATAAAACCACTGATAAAGGGCCTTGTAGAAAAC
AGAGTGTGTGACACTAGGGTTTTCCCAGGCAGGAGAGCATGGCAGTCATTCAGCGGGGCT
TCAAGTAAGTAAATCCATGAGCCCAAAAACTTCTCAGTAAAGTTTCCAACTTTAACCATT
TTCCAACTTAATCCAAAGGAGGTTAAAATATTTGAATTTTATATGCTCTCAATATTTGCT
TTCTAGATTATTTCTGATTTGTTAATTACTTATTTACTTAAAAAATGAAATCACTCCAGG
AGCAACTGGATCAACGGGAAGAACCCACACTGCAGGGCCAGGAGACCTCAGTTGGTTTAG
TAACCACTCTCTCCCTAGTTTCAGGCTGCAGTGTCCTAAGGCCTACTCATTGTCTCTGCT
TAGATGTTTAACAGGCATCTCTAACCTCACATTTCATAACAAAGCTTGTAATTTCTGCTC
TTCACCTCTAAACTGGTACCCCTACTATCATTGCCAAGTCAGTAAGTGGCACCATGGACC
ATCCAGCTGTGTAAGCTGAAACCTGGAGTAGTTATTTTTCATTCATTCCTTTCTTTGATG
CACCACCTCCTCCTACATCAAGTCAATAAGCAAGTCTGAAAACTCTACCTTCAAAATGTA
CTTTGAATCCAGCCACCTTCCTTCTTTCCATTGCTAACAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved