Felis_catus Locus Mono:6:SNORA40
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:6:SNORA40
Felis_catus
Mono:6:SNORA40
scaffold_137552
SNORA40
1001..1118
2118
TAAAATATCTGATAGAGACAACATCAGAAATTAACAGGGAAATGAATAGACTTTGAAAT
AAATGGTTGAAAATGGATCAAAATAGCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGAAATACTTGAAAACTAAAAAGCACAAAGA
TATGGAATTAGTATCCAGAATAAAAAAGAACACCTATTACTGAATAAAAAGGACAATTCA
AAATAAAAATTAAAAATCATAAACAGGCAATACATAAAAAACCAAACATAAGAAAAAAGT
TAAACTTAATAATCACAGAAACACTAAACAAAAGAAAACACATTTTTACACATCTGACTG
GCAACTATATTTAGCAATAATATACAGCAGTGAGTAGTCTCAATACACAGCTGGTAGAGG
ACATCATTGTCATAACCATTTTCAAAGGCAAATAGGCAAGAACTGTGCATCATTTTGACA
CACCAGAGATATTTTGAGAAACCTATCTTAAGATAAACTAAAATATTTTAAAAAGGAATG
TTATCATGATACCTACTAGTGAACCAAAATAGCAAAAATACAAATTGTTTTTGTTTAGTT
TGTGGACAAAGACTTAGACTTAGACAAAAATAAATTCTCTCTTGCAATCCAGAACTCATT
GTTCAAGTATGAGTTTTGATACAGGTAAGAAGGAACATGATACCTAAAAAAGATAAAAGT
AATGAGGGTATTGATAAACATGAAGGTTGGTTCCAGGACTACAGAATTACTAAAACCATA
TGATAGAAGGGAAATCTCAGCCATACTGAATTAGTATTCTAATATTAATGTTGACTTGAA
ACAAAGATGCCTTCTTTTTTTAGGTGTTTTCATTTGAGAATACAATGTGTGAGTTTAAAA
GTATTGGTGTATCCTAATAATCTGTACAATTCTAGGGTGTGATAGTTCAGGGGTGAACAT
GATTTGAACTTATTCATGTTTAGAGGGTGTCTGAAATGGCAGAACCAGACAGATCCATCT
ACTCTGACCCTAAATGAGGCCCTAAAGTAAAATTGCTTAAAGAAGCTGGATCCCAAAAAT
TACAAGTGGGGAATTTTTGAAGTATGTCCATATTCAGGGAGAGATCGAAGAAGCCCAACC
AAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved