Felis_catus Locus Mono:36:SNORA18
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:36:SNORA18
Felis_catus
Mono:36:SNORA18
scaffold_175419
SNORA18
1001..1133
2133
CTCTTTGTTCTGGCCTCCCTTACACCAATCCCAATCCTGTAAACTGGGAGGCAGGAACT
GCCCCCCACCGTGGAATTATCTAATTCCAAAATCATTCTCGCAACTGTCCAAATAAATAC
AAAAGGCCTGGTTAAATTTGAATTTCAACTAATGGATGAAAACCTTTTTAGTGTAAGTAT
GTCTCAAATATTGAGTCTTACTTATTCAAATTTAACAGAATCTCCTTTATTAATTTTCCT
AAATGCGGCAACCCTGTTCAATCGTTTAACCGTAATTTGTGCTTTTCTGAGTCTTAGGCC
TAGGCTTCTGCTTCCCAGCTTCTGTAGCAACCTATGGGTAAAATGAAAGATGGTGGTACC
AACAGGTATTCCAAGGACATGGGGCAAATAGAACTCTCATCCTTTACTGATGGGAGCATA
AATTCCACTCCTTCACCATACTGTTTGATACTTTCTACCAACCCTAGGGCCCAGCAATTC
TACTCCTAGATGTAGACACAACTGAAATACATACCTGGTCCACCTAAAGATGGGTACAAG
AATGTTCATAGCACTGCTATCCCATTTCTAATAGTCCAAACTAGAAACAATACAATGGCA
GCGTGGATAAATAAGTTGTGCATATCTATAGGATGATTTATTATATGACAATGAGAATAA
GTGAATTATTGCTATACACGACATGGTTGAATCTCACAATCTTAAATTTGAGCGAAAGAA
GCCAGACACAGAAGAATAAATAGTGCATATTATTAAATATATGTAAGGCTCAAAAGCAGG
CAAAACGAGGCTCTGGTGTTTAAAGACAAAGTAGAAGTTGGGCAGAGGGGTATGAGTTCC
TAAGAGAGTTCAGGAGGGCTTCTGTGGTGCTGGTAACGTCCTTCTTCTTGAACCAGGCTG
TGGTTACAAGGACTGTTCACTGTTAAACTCATCAATCATGCTTATGAACTCTGTACTTGA
CTACATGTATATTGCACTTCAATTAGATGTTCACTGAAAGAGTTGAGGTCTGTCCTGATG
GGGCTTTTTTCTCTGCAGACCTACATTGTTGGAAACACCTCATGGAGTACATGTGTGGTT
TCCTTATTCACGGAACTATGTGTTAGATCTGTGGGAAAGAACTACAAGACATCTCTCTGC
TAAAATTATGTGAAAGACCTAATAGTCAACTTGTTTAAATCTTAGGTATTGGCGTATCCC
AGCAATCTGTACAATTCTGGGGTGTGATAGTGTAGGGGTGAATATGACTCAAACTCATTC
ATGTTTAGAGAGTGTCTGAAATTGAGAACCAGGCCGATCCCTCTACTCTGACCCTAAACG
TGTCCCTAAAGTAAAGAAACTGGATTCCAAAGAGTACAGGTGGAGAATTTGTGAAGCATG
TCCATATTCAAGTAAAGGTCAAAGAAGCCCAACCGAAAGAACTCTGGACTGACAGTGACA
ACTGTGGATTGAACAAAAGTTCTTTTTTTTTGTTTCTTAATGTTTGTTTATTTATTTATT
TTGAGAGAGAGAGAGCAGGGGAGGGGCAGAGAGGGAGAGAGAGAGAGAGAAAGAGAGAGA
GAGAGAATCCCAAGCAGGCTCTGAGCTGTCAGTACAGAGCTTAATGCAAGGCTCAAACCT
ATGAACTATGAGATCATGACCCATGCCGAAATCAAGAGTCGGATGCCCAACCAAATGAGC
CACCCAGGTGCCCTGACCAAAAGTTATTTAAAAAAAAAAAATTTTTTTTAATGTTTATTT
ATTTTTGAGACAGAGAGAGACAGAGCATGAACGGGGTAGGGTCAGAGAGAGAGAGAGGGA
GACTCAGAATCGGAAGCAGGCTCCAGGCTCTGAGCTGTCAGCACAGAGCCCGACGCGGGA
CTTGAACTCACGGACCGTGAGATCATGACCTGAGCCGAAGTCAGATGCTTAACCAACTGA
GCCACCCAGGCGCCCCCCAAAAGTTATTTTTAAAAGACAATTTTGGGGGCACCTGGGTGG
CTCAGTCAGTTAAGTGTCCGACTCTTGGTTTTAGCTCAGGTCATGATCTCACTCATGGTT
TTGTGAGTTCAAGCTCCGCATCGGGCTCTGCGCTGGTAGTGTGGATCCTGCTTAGGATTC
TCTCTCTGCCCCTTCCCCACTCGCACTGTCTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved