Felis_catus Locus Mono:115:SNORD65
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:115:SNORD65
Felis_catus
Mono:115:SNORD65
GeneScaffold_945
SNORD65
1001..1074
2074
TTGAGCAGTGACCTTTATTTTCTGTATTCACCCAGGTTGCCAGTGTCCGATCGTAGCAG
CTGAAGATTCGAGTGATGAGTGGCCTGCCTTGAGGTGAGTTTTGATCTCTGGAGAAGTTT
AGTGGTTGAGTGAGCCTCCCTGTTACATTAGGTGAAGTTCCCGTTAGATAGTGGGAATTT
TATCGGTTAACCTAATCCCTTGTATCCGTGTAGCCCTTGACCTTTATTGGCAACATCTCT
GAGATCCTGATGATGGTTCATAGTGGTCGTGGAGCTGAGTGCAGAGGAAACCCAGGAATT
TCCTTTTCATCTCACTGCTGTATAATCCTGAGCAAATCGCTTATTTGCTGAGATTGTTTT
CCTCGTCCTTTAAAATGGCAGCTTTAGGTCTGGGATCTTTAAAATGATGTGACTAGGGGC
ACCTGGGTGGCTCAGTCATTTAAACACCTGACTTGGCCTCAGGTCATGATCTCGCAGTTC
ATGAGTTCCAGCCCTGCGTTGGGCTCTGTGCTGACAGGTCAGAACCTGGAGCCTGCTTCA
GATTCTGTCTCCCTCTTTCTGCCCCTCCCCTGCCCGTGCTTGCTCTCTATCTTTAAAACT
AAGTATTTTTAAAAACTGATGTGACTTAAGTGGAGGTTACGATATCCAAAGAAGCCACTT
AAGACTTTTAGACTTCTGTGGTTTAATTTACAAAAAAGCATCTCCAGAATGTTTCCAAGA
ACTATTACGATGAACTTGGGAGCTGTAGTTGAGGCTATCCTGATAAGACCTACCTGTTTT
GTCTTTGGTGTCTGCTGCCTGTCTAGGGGTGCCTGAATTGCCCCAGGTTTTGAGTGCTGG
GTTGTCGAAAATCAGCGATCAGCAGTGTGGAGTTGAAGCCAGTGGTGCCACAGCTCAGCC
CAAGTAGGGGTAAGCTTTTGTCTGGACAAGGGCCCCCTCCCCCTCCGTGGTAGAATGAAT
AAGCTAATTTTGTGTAAACTGATATGCAGAAAAAGGATATCAAATGATGAAATCGCCTAA
AAATAGCTGGAATTACCGGCAGATTGTGTAGTGTTGAACCTGTGGTTTTCTGAAGATATC
TGTATGCTATGAATAACCGTTGGTCGGAGTAGAGAGTCCGTTGGTCGGAGTAGAGAGTGA
GACTGATACTTAGTGTCTTTGCAGGCTATCTTCCCAGAGAATGGTCAGCCATGCGAGGAC
CAGTGACCACCATCAGCTTGGACTGAAAACCTAGACTTCAGTAGTTGGTGTGGAAACAGT
ACTTACCTGAGGCTGAGATTCAGAGCCCGTTCCATTACCAGCAGTTGAACCAACAAATGT
GTTTTTGTCACTGTTGGTTTTCTAGTGTTACAAATATATTTCTAGTTCTCCCTTGCCCAA
AGAGCTTTCTGCACTTTTTAATTTTGTATAAATTCTGTTGGGTGAGGGTCTGAGTTCTTA
AGCTTAAAGCTTATTTCTTCCTGAAATTAGCATTTCCATGCAATTACAATAAACCAGTAC
TACGATAAAGGATGGTTTTTAGTATTGATTCTTAAAAATGTATTTGGAGAAAAGTTTGAT
TACTGCTGTTACATATGAGCAGTCCGGGTATTGGCATTTGTCAACATCTGTATGGTCCGG
CCTAAGCTGTTCTCCTGTAACAACTTCAGACTTTAAGGGTGAAAGTTCCAAAGCATTTAA
GGCATCCACACCTCTGATTCCAGTCTGTTGCCCTTGGGCCACGTCCTTTTGCATAGCCTC
CACCTCCTGAAACTATGCTTAGTCCAACCTTTGAGCAGTGGCAGGCAAGGTGCCATAGTC
TGGTTCTTGACCTCGCCCCCATCTTGCTGCCTTCCTGAGTTGGGATCTTGCCTGTCAACG
AGGCTGGAGGCCTGTCAGGCCGTGCTTCCCAGCTGTCTGCCATTTGCCTGAGCAGTCTGG
TCACCATCTATGGGCTTTTTTCCAGCTTAAAAGGGCTGTTTTCCAATCTCCCTGGACTTG
AAGTCTATGCCTTGGGTCTAGGCTTATTGTGCCTAGAAGGCTTGTAGGCCTTGAGTAAGA
AGAGAGGGTGAAAAAAACCTTTGCTTCCTCTCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved