Felis_catus Locus Mono:49:SNORA46
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:49:SNORA46
Felis_catus
Mono:49:SNORA46
scaffold_192697
SNORA46
1001..1138
2138
CCACTATGATTATCATGTAGGATCTATGAAAAACAGAACCTTGCACAGTGCCTGGCATG
TAGCAGATGTACAACTAATATTTGTTAAAGAAATTAATAATTTTTGACTTTAAAATTTGG
CATATATTTTACTTTTTAACAGCAATTAGTATCATTTCTAAAACTGTATAACCGACTATG
AAGTAAATTTAAAAAGTTCTTGTTCTCCTCATGTACCACTACTCTCCAAACTTAACACTA
ATGAATCCTATGAACAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
TTTCCTACTGTGAAAACCTGCCTATCCTTGTCTATTCTGCATATACTTCTATTTTCTACC
CTACTGTATAAATGACACAGCTTCAAAATTCTTAAACCACACTTCTATTTGAAACAAATT
TACCAACTAAAGAGTTTTTGTAGCTAGTCTTTAGCTCTACAGTAACCACTCAAAATACTG
TTTTCCCAAGTTACATGTATCAGCTTCTTTCCCATTCTTCAGTGTCCTTTTCAATTCATT
GGAAGACAGATTCATTTGTCACAGCCTACATTCCATCTTTCCCCTCACAGCCTAGCTGGC
TTTTTCAAAAATTAACATGCAGGCAAACTCATTTGCTTTGTCCTGTATTCTTCTGTCACT
GTTAGCAAATGCACAGTGTCACGTAGCTGTGAGCACGGTGTGTTTACCCTGGAATCCCCT
ATGTTCCCATCCTCTCACCTCTTACCCACAACACTTGGCAATCACGGATCTGTTTTTCTC
CCTAGCTTTGCCTTTCCTTAATTGTCATATAAATTGAATCACACAATATGAATCTTTAGT
TATTCTTTTGCTTAGAAATGCGCATGTAGGATTCTTGAATGTTCTTGAATATATCAATTC
AAGATACATTGTTGTTCTTGAATATCAGTAGTTGGTCACAGCACTATATATCTAAACCTG
TCAATGGGAATTGTCCCCTTTCTTGGTCCCACTCTTGTGTGAAAGAATTCCTGGCTCTTT
CTGTCGCACAGCTGACTTCGTGCCATTCTGCTGTTGCTGTATAGAGTTAGGGAACATACC
TTAATAAAAATAAAAATAAACAGTTTGCCATTTTTGGTTGTTCGAGCAGCATTCATTGTA
TATAGTGCCATACTTTGTTTAGCAGTCACCAGTTGAGGGGCATTTTGAATTGTCTTCAAT
TTGGAGACATTATGAATAAAGCTGCTATTCAATTTAGTCATTTTTGAATATTTGCATTCT
TTAAATATTTGTGTTGTGGTGATAAAACTGCATTCTAAAAAGTATTTTTAAAAATATTAA
AAAAAAAACAACTTGTTATGAGTTCCCTTCAATTACTTTATTAGTTTGTGATTGCAAACT
GACTTCAGACCTACTCTACTCAAGGCTTGGGGACAAACTTTCTGTGTTATTTTAATATCT
TTCATGATAAGGTAATTTAAGAATGAACCAAGGTTTGGCCTTTTGCAATAGAAAATATTT
TAATTTTCTGAAGCACTATTGGTGTTCTCAAAGATTATTGAAGATAATATTTATAGTAAT
TTTGTCTCTGGCACTAATAGTTTTTAATTATGTGTCTACTGTATAAAAGTCTAAACTCTT
TTTAAAATTCTGAATTGGTATTGAAATTAGGTTAGATTCCTATGTGTACTTTGAACTAAC
TATCTCAAATAGTTAAATTACTTTATAAAACTAATTTTATTCCAATTCCCCAAACTATTT
TAGGAACAGAAAAGATAAGCTCTGTCTTCAAAACCTTAGTCACTATCTGTCCTTTTCCTT
CCAAAACTGCATTTCAGAAAATAAAAAGGATTTTGCAAAAGCTGGTTACTGTTTTACAAT
GGAGCTGTTTAATAACTTTAAAAATTACATTGATTGAATGGTTACAAGACCAAAACTAAG
GAAAGATAATTTTAATAATCCCTCCTTTATCTAGACATGCCGGAGCTTTTTATTCCATAA
ATGAAAATTTTATTTCATTATCATTATAATAAGTAAAACAAGTGCCTTTGTCAGAGGCTA
GAATTTCCAACTTCAGTTAAACTTCAACATGACTTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved