Felis_catus Locus Poly:0:snosnR60_Z15
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:0:snosnR60_Z15
Felis_catus
Poly:0:snosnR60_Z15
scaffold_128053
SNORD78, SNORD79
1001..1065, 1395..1469
1726
GAATTGGGTTTTGAAATGATGTTGACCAAATGTCTGACTGAAAGTGAGCATGTAGACAA
ATTTAACACTGAAGAACCTGTGACAAATAACTCTGAGAAGAATTCGGTGATAATTAACAT
TTTAACGAAAGTGTCTTGTTTTTTTCTAGGTTACTGGCCACTATCCTGGATGGCTTGCTT
GGGGTAAGACAAAACAGTTCTTTGGTTGCTGAACTCAAGTTCGTGTGTGGCCGAAATGTG
CTATAATGTGTTCAGTGTGTTCTGGTGTTTCAAGGAAGATACAGCCATTGTGAAGTGCAT
TTAAAATTTTTTTTTTTTTTTTTTGGTCAGGTGCTGATTTTGAAGAACTTTTTATATAAA
GGTATGTATTCTCTAAACCTTTTTTGGTTAACAAGCAAGATACTGTTAGTGATGATTTTT
GAAATTAAAAACAGATGGGAATCTCTCTGAAAAAGAGTGAAGATTTCTTAAACGCTGAAA
CAGTATTTGGAAAAGTTGAGAAAGCCACTTGTTACTACCTGTTAACTAAATTTGACTAAA
TTTTCTGCAGGTGTGAAGAGTTAGTGGCTCACGAGGCCCGGAATGAGGAGTTTTAAGCCA
AGGTATAGTCGTTTCAAGTTGGGTGTCTATATGAAGTGGTTTGAAGCCGATACGGTGATG
AGAACATAGTTCAGCAGACTTGACAGTGATGAGCAACATTGTCTTTCGCTCCTATCTGAC
GTATCTGGCTGCAGCAACCCTATTCATACCCTTGAAAACGAGCCATTTATTCTACCACAG
GAAACGTTCAGGGTTGGGGTAACTAGTGGCTTATATACAAATGTTTTCTTTAGTTTATTT
TGAGGGGTGGGGGAGGAGCAGAGAGGGAGACAGAATCCACTCTGCAGAGTCCAGTGCAGG
GCTCCATCTCCCTGACTTCATGACCTGAGTCGGACATTTAATTAACTGAGCCAACCAGGC
ACCCCAGATGTTTCAATTTTACGATTTCACATTTTGAGGAGCACAGGTAAAGTTTTTGCC
AGGAAATTGTAATCTTTTTTTTAATAAGCTTCATGTTTTAAAGCAGTTTCAATATTGACA
ACAAAATTGAATGTAGGATCCCATATATCTGGTCTTCACACCTTCCTCAACATTCAGCAC
TAGAGTGAGACTTTGGCTACAATTACGAACATGCAATGAGACCATTATCGCCCAAGTCCA
CAGCTTACATTAAGGTTCATTTGTGTTACACGTTGTATGGGCTTGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGTGAGGAAATTCTGTTAAGCACTTTCCTATAGTC
ACATTGACATCACTTCAATCTTTTAAATTCCTTCTACAGGAAAGGTTAGATAATCCATGG
TTCATTATTGCTTTTGGTACCAGTGGCCACCCCAGTGTCTCCCAACAGGCTCTGAAGAGA
CCCTCTGAAGCAGGAACCATCACTTGGCTCCAGCTCTCCCCCTTTTCATTCTTATCACCA
GTGGTGACCTTTCTTGGCATTACATATTCTTAGTTTCCTCTAGGAGATTGTAAACTCCGT
GAAAGGGATTTAAATCTTGTTTGTTGCAGTATTTCCAAGCTTGTCATTCAGGCAGTCAGT
GTTAGAGTAGATGGATTAGGTCAGTCTTTTAGAAATTTAGTGGGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved