Felis_catus Locus Poly:2:SNORD113
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:2:SNORD113
Felis_catus
Poly:2:SNORD113
scaffold_147190
SNORD113, SNORD113, SNORD113
1001..1075, 4383..4457, 6065..6136
7136
AGATACTTTCGATATGCTTATTCCTGTGTCGTGTAGTTGACAGTGGCTAATACATTATT
TAAAAGTGAAGGTAAAATGCGAGACTGTAAAATGAAGAAGTGCCCAAGTTTATTCTAGTC
CCACCTAATTCACATGCATTAAAAATCTAGATTAATTGTACTTTTTCCTTCACAGAATGA
CCATGAGACAGTAGATGTATTCATTTTCTAAGAAACAAAATATTGGCAGTTAGCTCTGTA
TGTAGAGCTAGACAGATGTAGAGACAAGTGTAAGTAACACTCACAGTTCCCATCCTTGGT
TGGGATGCTTTGGTTGATGAGTGTTTAGTGGTATAGCAAAAGAATCAATGTCTATAAAAG
TAATAAAAATCTCCAAATATGGGCCGGTGATGGGAATATGTCATGAATCAAAAACTATGT
TTAATCTAATTTGGCACAAATGAAGTGATTAAAAAAACCGCCATTTCATTCATTTTCAGA
AGTATTTAATATTGCAGTTTATTTCCCTCCCCAGAGGGCTTAACCATTTCCGTATTGGGA
TAGTCCCGGCTGATAACTGTTTTGCGTTGCAACCTGTAAGCAAGTAGAATGCTTTGTTTT
GAGATGTGAATAAAGATGGTGTGGTGTCATCACTTTTCACTGAGCCATCTTCATGGGGAA
ATCAGGGGCATGCGCTTTCAAGGGTCCCCTCTCTGAAAGACAGCTTTCATACTGTTCTTC
CTTTCTGATCTTCTACTCTAATAAACATCTGCCTGCTGCTCAATTAAATAGAAGAAAGCC
ACAGAAGGACCAGTGGTGAATGTGGATTTGGTATGAAGCATGGATATTAACTGACGACAC
GTATTCTCTGAGGTCCATTGTAAAAGGAGATTTAGTCTATTTGCTTTATGGGGAAAGAGC
CATTAATGCGAAGATCTTATCCTGGAACTTTATGATAGTGTTGTATTCATGGATCAATCA
GTCAACCAATCAATGAAGATATAAAGGAAGAAAAACGTGCCTGGACCAATGATGAGTACC
ATGGGGTATCTGAAACAGGAGTTTTGATTAAACCCATATGCAACTCTGAGGTCCATTACA
AAGAGACACGTAGTTATTTCCCCTCTGCGGGAAAAGAGCACATGTTACCTTTTGTGGTTC
TTGGAGATGGATTGTATTTTATTATTATTATTATTTAAAAAATTTTTTTAACATTTACTT
TTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAACAGAGTGCAAGTGGGGAG
GGGCAGAGAGAGAGGGAGACACAGAATCCTAAGCAGCCTCCAGGCTTCGAGCTGTCAGCA
CAGAGCCCGACGCAGGGCTCAAACCCACAAACCGTGAGATCATGACGTGAGCTGAAGTTG
GACGCTTAACTGACAGAGCCACCCGGGCGCCCTGGATTGTATTTCTTTTTTTTTTTATAG
AATCAATTCACAAATAAATAAAATGTATCAATGAATGAAAAAAAGAGGACAAATTTATAC
GCTTATTAAGGGAAGTAATGCAACATGGAGTAGTCATATGAAAATCTGGAACTCCGACTT
CCCAAGAAATGGGTCATGAAAGGAGATATGGTCACTTTGCACATAATCCCTCAACAATGT
TTGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGCAAGAAGGT
GTAATTTTATGTCTCGATCTATTTTTAAAAGTCAGCAGACTGTGGACCAATCAGGAACGC
GTGTTTTAATACGAGGATACCGACTCATCTTAGTTTGCCAATGACAAATATTCTAGGAAC
AATTTTAGGCTCTTCCATTTTTGCAAGGTGCATCTGGACCTTTCCAAGTTGTGGTAATTT
GGGTCCGGGCTGGTGTTTGACCATTCTGAGTTTCCGTTAGAAAAATGGTATTGTTATTCC
CTGAATAATAAAACACACCAGGGAGTGAGTGAATCCATGAATCTCCATAAGTGCATGTAG
TGGAGGACTGGGAGATTGTGCCAGGAAACAAATATGGTAAATTCTACACAGCCAAGTCCA
ATAAAAAGATGATCGCGGCTTTCCCTATGTAGGTAGCAAGGAAAGTCAGATGTCTCTGAT
TGTTAATGTCTCTGATTGTCAGATGTCTCTGATTGTTAATCGCATATTAACAATGCGATG
AACACATCGCATCGTGTTGAGCGATGAATTCAATAGTATTCCTATCAACTAATAGAAGCT
TAACTCAGTAAGAGTACCACCCTTGAGAAATTGGTAAGAATGTGATATGAAATAGGGCTT
CTGATTAACGGTTCCTCTCGGCACATTTCAATTTAAAAAAGCGCACTCTGTCTTCATTGT
TTTTACAAATTGGCTTCCCTCCCCCCTTTTCCTTTGTTCATAGAATGAACACACAGCTGA
TTTAATCGTTCTATGATCGTGAAGACATGGTTGTGAATTCTGGGATGAGAAACATAAAGA
CCGAGGTAAGTAAATATCAGTGTTTGCGTTTAAGGCTTAGATGGGGTTTATTTATGGGAG
CCCACTAAATTATTTCAATAAAATAAAGAGTTAAACAATGTAGGAAATTCAGGCATGCCA
GTCATGAGCCCCAAGTCTAGAATGTGTCACAAACTAAAATTTATGATTACTTTGATTCAT
CCCAACTAAGAGCCGTTGCTGAAGTGATGGGGGGCCTCTCACATATTCTCAAAGCAGTCT
GCCTTCTCAACTCATGCTCTTGTCCCATTTGCCTAAAACATACCTTCACTGGGGAAGATC
TTAGCTGTTAACTCTCTGAGGCTGGAGCACCCCGAAAGATGGCAGATGTCAGTTTTGCCA
GGTGTGGGTTAAGATGACAGGTCTGTGGGTCTCGATGACACTAGCTTTACCGTATGGGCA
AGTCAAGGGAGAAAGGAGAAGGTGGTCACCAGTCCCTAAGTAAGGGACTGATATGAAGGG
AGCGTCCTGATTAATCCCTGTGTGCAAAACAGAGGTTCACTATGAAAAGCGAGTGACCGT
TCGCTTTCCATGAATGGGGGCGGTGAGCAGATCTCGGTTGTATGTAAGCCTTTTGTTCTC
AGTTTTGTGTCATTAAAGGGTATTGAGTGTATAATTCGGATTCATGAATCTATGAATGAA
TCCTTGCAAGAAGGCATAAATGAACGAAGAACTCGAAAGCTGTGCCCAGATCAATGATGA
GTATCGGTGGAGTTACCCGAATCAACACCTTTGATGAAGTCCTCTGTGCAGCTTTGAGGT
CCGTTACAGGAAAAGAACCAGTCAATCTTCTCTGTAGAAATTAGCTAATAGTGGAAGTTA
GGAAAATTCAATAAGCTTGCCCCAGGCTTTTGTGGTTCATGGATACGGATTATGTTATTT
CAAGTGAATCAATGCATGAGTAAAGAAAGAAATGAATACATGAGACGCTAAAAGCCTCCT
CATGGAACAGTTAGCGGAGTGCAGCAAACGCTGTTAATATCGATACAATTCTGAAGGAAA
ACGGCAAGGCTCACTCGGTAATCCTCTTTTATGTGGAACGTACTAGTATCTGTAGTTAAG
ACCCAGTGTCTTGAGTGTCTGTAGTTTGCTGGGGAGTTTTTAAGCTAAGAGAAGGGGAAG
TGTTTGCATCAGTCAGTAATCTATGAGATAACCGTCTCTTTAATAGGCGTTGATACAGGT
GGAGATTTGTAATCGTTATAGCTCTTAATCTTGGGCTGGGTGTTGGACTTGATCGTGTTT
ATTGTATTATTTATAAGTAAGAATTCCATACGGGTTTAATAAAGAATAGGATGCTGGGGC
CAAAGTTTATTGCTATCTAGCTCTGCCTGATGAACAGCCATTAAAATTTTTTTTGAATGT
AGCCTTAGTCTCCTTTTTCTTACCCAGAGTGAACAATAGCATAGCTGACTCAGTCATTTA
GTAAGGAGTTATTGTAGTGAACCAGGAGCATGAAGAATAATTTAAGTAAGTCCCTTAGTT
TACATTCTTTGTTTGGATGGGTTGTTCACGGATGTCACCTGAAGAGTTTCGAAGCAAATA
ATTGTGCACCACACACACACGAATAAATAAAACACTCCCAAGTATGGATCAATGATGGGA
ATGTATTATAGACCCAAAATTATGTGTAATCTAAATCAGCACCGCAGAGGTAATTTTAGA
AGAAAATATAATGTTATTTAATTTGTTTTCAGAGCAGTTTCATATTATTTCTTTCTTTAC
GTTTATTAGCTCTGCAGGAGAAAATCCTAAAATTCAAGGATCTTGTTTTTCGGATTTTGT
GATTGTGTTGTTATTATTTGTGAATCAGAAAATGAATTAATAAACAAAAAAATTTTCCTA
GCATGGACCAGTGATGAATGTCATGGGGTTTCTGAAACAAGAATTTTGATTAAACCCATC
TGCAACTCTGAGGTCCATTACAAAGGAACACCTTATTATTCTCTTCGTGGGAAATAAAAG
CCTTCAGCATCTCATTCGTGGGCTTTTGTGGTTTGGGGTATGAATTGCATTATTATAATA
CAATTAGCCCATGAATAAAGAAATACATCAATGAATAAAGAATAAGAAGGATATGCATGT
ACTACTTTTAGGGCACACAATGAAACAGGGATCATTATTACAACAATTTTGAGATTCTTA
GCCCTAATAAATTAGCAGTTAAGGCTTTTATCACTTTGGTGAGGGGCATATGGTCAACTG
TGCCTAAGAGTCAATGGTTTGTTCTGTGTTGAGGCACATTGCCAATTGATCATTCTATTA
AGGAGAGGAAAATACATTTACATAAATAGTTGATCAAATAAACTATCTAATTGAGAGAGA
GAGAGCATGGTGATACTGTTTCATACGGCCACACTCATGATTAATGCAGTCTTCTTAGGC
CGTTTTGTGTAAGCAAACAAACACTAAAGAATCAGTTCGGTATTCTTCCGGGTAATGACG
TAAGGACAAATGTAAATATTATTCAAGGTACTTCTCCAGTGTGGGTGGGCTGACACATAT
TGAAGTATAATTATAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAT
AAAGTCCAATAAAATAAAGAGGTGCGGATCCATCGGTCAATGATGACATTCTTTTCTGAA
AATGACCCGTGTTTATGATTGATTTAATACTGCAAGACTAGCCTTCCCATTTAAAAAAAT
CTAACTTTGACTCTTTCTTTCTCTGAAAAGTCTGCATTTTCACTAAGTGAACACACCACA
GATGAAGTAATCATTCTCTAATGCTAAAGATCTTGGCTTTAGCAAACTGTGGGGGTAAGG
ACAGAAGAAATTGATGTAAGTAGCAGAGTTTATATTCTTGGGTTGGGAGGGTGGTTTGTG
AGTGTTGCTTGGATTTTTCAAAGTAATCAACGAGTATATTAAAAAATAAAGCCAAATGAG
CCCAGCACAGACCCGAATTGAGATTTAGGTTGAATCAGATGCAGGACTAGTAAAACCCAG
TTAAAAAGATGCTGGACGTTTCATTCAGTTTTAGGATTGCTTCACATTGTGTTTTATTTT
TGCATTGCAATGCATTTAAGTACTTCTCCATTGATAAAGATTTAAGCTATGAATTCCTTG
AGGGAGAAACACACAAGAAGATGGACAAAATTGTTGTCTCTCTAGATGTGGAGAAAGATT
AAAGTTCCCATGGTTACTCACTGCATCATCTTTAAGTGTAAAAGGGCCAGGCGTGGACCA
TTGAAGCTGATACGGAGCGAGAATGTTGGTTAATTTATATATGCAAACAGCATACGTATA
TATTGCAAAGAATACCCTTGTTTATTAGCACTGTGGGAAATGGGTGTAGAGCCGGTTCTT
GGTGATATTCAAGGATGTCGTTTTTGGGCTCTTTGATTCATGAGAATAGATTATATTGTT
ATGAGTGAGTCCATGAATGAAGGAACAAGGAATGTGTAAATAAAGGAAGAACAAGATGTT
CGGTGTAGATTAATGATGAGGATTCTGAGATGTATGAATCAAAGATTTTAATTAAACTCT
GTACCTTTGAGGTCCACTGAGAAAAAGAAATCTAGCTATTTCTTCCGTGAGAGAGGGGCT
TACAGCACAAGTTAGGACGAGTTAAGATCCAGTTCCTGAGCTTTGAATTCTTAATGTCTG
TGAAATGTATCATTATATTATTTCCCCAGACACTGAATTTCGTAATCTAAATCGATCAAG
TCTATCTCACATTTGTCCTTAAAGGATAGATATCCTATTCCATGAGAGTCCCTGTTGTTT
CAGATTGGTGGTAGCTAGCTGGTTGTTGGTTCTATTTAGAAAAGGAGCAAATCCGGGGCA
CCGGGGTGGCTCAGTCGGTTAAACGTCCGACTTCAGCTCAGGTCATGATCTCACAGTTTG
TGAGATCGAGTCCCGGGTCGGGCCCTGTGCTGACAGCTCGGACCTGGAAGCTGCTTTAGA
TATTTGTGTCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved