Felis_catus Locus Mono:84:SNORD35
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:84:SNORD35
Felis_catus
Mono:84:SNORD35
scaffold_9240
SNORD35
1001..1087
2087
GGTTCACCAGGTGATGGCCTGAAAGACAGTGAGAGAGGCTGGGAGCCCAGGTGACCCAC
TCAGAGCACCTGGAGGACACCTGCGACCCCCGATCACATACTGTTCACATGTATGTGTAT
GCACGTGTGTGCACGCGTGTGTGTATATGTGTGCACGTGCGTGCATGTGCATGCATATGC
ATGTATCTGCATATGTATGTGTGTGCATGTGTAGTGTATCTGTGTGTGCCTCTGTGTGTA
TCTGTGTGTGTCTGCGTGTGCACGTGTATGTGTCTGAATGTGTGTACGCGTGTGTATGTG
TATCTGTATACGTATATGGGTGTGTATGTAGGTGTATGTTGTACATATGCATATGTGTAT
CTGTAGGTATGGTGTATGTATATATGTATCTATTTATATATAGTAACACATGCATATGTA
TATATTTAGAAATATATATGCATGTGAGTATATGATGTATATGCATATACCTACACACAC
ACTTATACGTGTGTATATGCATATAATATGTATATATGTGTGTATACATGTATGCATGCT
TCTACATGTACATATGCATGTAACATGCACATATATGTGTGTACATTGCATATATATGTA
TATATCTTACATACCTTGAGCCTTAGGATACAATTATCCAGTAAATGAAATTAAAAAGCC
TTTGCAATGAGTGGAGGTGGTCGAAAGATACAAACCTCTGGTTATATAATAAGTAAGTCT
TGGGAATGTGCGGTAGAAGCGTGACGATTATAGTTAACAATACATATTATATGTTTGAAA
GTTGCTAAGAGAGTAGATCTTAGGGGCACCTGGGTGGCTCAGTCGGTTAAGCATCCAACT
TCGGCTCAGGTCACAGTTGCATGGTTCGCATGCTGGCAGCATGGAAGCCCCTCCCCTGCT
CGCTGTCTCTCTCCAAATAAGCAAATATACCTAAAAGAGAGAGAGAGAAAGAGAGAGAGA
GAGTAGATCTTAAAAATTCTCACCACGAGGAAAAAAACTTGTGCAGATGATGTCTCTTCC
TCACGATGGTCTGCGGGTGCCACTGTGGGTAGAGCAGATGATGCCAATGGCCCAGCTGAT
GCCAGGAGGAGGGAGCAGGGAGCCCTTCCGGGGGCGGGTGTATCTTTCGGCTCGGGCCTG
CTGAGACAAGGGGGGTCCGCTGTGACAGCTCGTCACCTCTGCCCCTTAGCCACCTTGGCT
GCTCTCTGTCATAACTTCACTTCTCCCCCTGCCCCCACAGGGGAAAAAAAGAAAATCGTG
GCCACGTGTGTGGATGGGTGTTAAGTAAGCTGATGGGGGTAATCATTTCTTAATATATAT
GTATGTACATTGTATACCTTAAAGTAACACAATGTTGTATGTCAATGATCTCAATTGTAA
AAATAAATCAATAAGTACACAATGCTTAAAAGCCTTTGTATATCTTAGTACTGACCGAGG
CCTCTGAGGAGGGGTTAGGAATCTTGAAAGTGGGCCTCATGCCCTGCTGTTAAAAAGGCA
ACATACAGAGAAAGACAGATACCACATGTTTTCACTCTTATGTGGATCCTGAGAAACTTA
ACAGCAGACCACGGGGGAGGGGAAGGAAAAAAAAACAAAGAAAAGAAGTTAGGGAGGGAG
GCAAACCATAAGAGACTCTCAAAAACCGAGAATAAACTGAGGGTTGATGGAGGTGGGGGG
GGAGGGGAAAGTGGGGGATGGGCATCGAGGAGGGCACCTGTTGGGAGGAGCCCTGGGTGC
TGTATGGAAACCAATTTGACAATAAATTTCATATTTTAAAAAAAAGATAAAATATAGAAA
AAAAAAGGCAACAGACGAGGTGCCCGGGTGGCTCCGTGGGTTAAGGATCCTACTCTTAGT
TTTGGGTCAGGTCATGATCTCATGGTTCGTGAGATCGAGCCGAGTCGGGCTCTGCCCTGA
AACTGCGGAGCCTGCTTGGGATTCTCTCTCCCTCTCTCTCTGCCCCTCCCCCACTTCCGT
GCTCTCTCTCTATCAAAATAAACATCGAAAAAATTTAAAAAAAAAAAAGCAGGCAGCAGA
CTTTCCGACGAATACAATCAGAACTGTCTCTGAGACCTCGTTTCACCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved