Felis_catus Locus Mono:108:SNORA43
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:108:SNORA43
Felis_catus
Mono:108:SNORA43
GeneScaffold_3503
SNORA43
1001..1134
2134
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGGCTGGAAATGTGCCCTTGGGCCAAGGTGTAACCTACCAGCTCTTT
TCTTGCTGGCGTGAGCTGGCTAGTTCCATAGCCGCCCCCCACCCCCGCCCAGCCACTTCT
TTCTTTTGTGTGCTTACTTCTGACTTGAGTTCCCACCTGTGACTGCAACCTGCTTCTAAA
TAAGTTAATTCCACATAAAGGGATAGAGGGATGCTTGACCTGAGAAAGAAACTCCATTCC
AGAATTTGACATGCATTTATAACAACCTTCACTATTGCAGTCGGGAAGGAATTCGTGTTT
TCTGGATTCTCAAAGTCTAAATGAGGCTGATGGAGAAAATGTTAACGCCGCCAGGAGGAA
TTCAAGTATTGTTCAGGGTCAGGATGCCTTAGTGCTACCCCTCCCTGCTCACCACTGAGT
AAGCCAAGAGAGCTGAAACTTGACGATAAAAAAATTTTAAGAAGTAAATTAAAGAAATGT
AAAAGATGGTTAAAAATCATAAAAAGAAAAAATTGTGATAAAACAGAGGGGGAATCTGGG
GCACCTGGGGGGCTCAGTCAATTAAGTGTTAGACTTTGGCTCAGGTCATGATCTCCAAGT
TTGTGGGTTCGAGCCCCGCATGGGGCTCTGTGCTGACAGCTCAGAGACTGGGGCCTGCTT
TGGATTCTGTCTCCCTCGCTCTCTGCCCCACCCCTGCTTGAGCTCTGTCTCTCAAAAATG
AATAGATATTGGGGGCTGGACGGGCAGGAACGGCTGCCCTGCTGATGCTGGACCTGCTGG
CTCCTCAGATGCAGCTGCGCTCCTGCACCTGTGACACTGGGGCTAAGAGGAAGCGGCCGT
TTCTACGCTCAGTGCTCAGAACAGTGAGCACTCCGTGGTTTGTAGCCGAACATGCTTTAC
AGCTGCCGGGGAGGCAGTTTTTACGTGCACGAGGCAGGCAGACCTACCTTTGGGCTTCTA
GCTGGGAATGCCGAGCACGGTACTAACCACTTCGGTTTTTGGGTTCTTTGTCTATAAAAT
GACACTTGTTGTGAGGGTTACATGAGGTGTGCAGGGAGATGAGCATGTGGCCGGCCTTTG
GCCCAGTGGGATCGACCAGGAGAGGGCCTCCCTCTTGGAAGTGATCATTCTGTAGGTCTG
TCTGGAGAGGGGTTTCTGCAAGTCTTTGGGCAAGTTCATGAACCCCTGGCTGCTTCCAGG
CCCTGTGCCCACACACCCTGTTCTAAGGACCCTTGAGACGGCAGAGCAGGAGCTGGGCTT
GGAGGGGGTGGGGAGTGGACACCAGAGGGCCACACCTGGCTTTGTCCTGCCAAGGAGACA
CTGCAGTAGGCCACCTAGAACCCCATACGCAACCCTCTAAACCAGGGCACTGGTGAGTGG
AGGGGGGCAGTCTTGGTAACCCCGCTGGGGTAGCAGGTGTGATGAGGGCTGTAAAAGAAA
AAAAAATGAATAAACATTAAAAAGAACAATTAAGAAAAAAAAAAACAGGAGGGAAACAAA
TGTAAAAGCAATGAGAGAAAACGAGATAAATATAAGCTAAGCAAAATGTCAAAGTGAGCT
AAAGGAAGGTCGTGTAAAAAAAGAAAAATGTAGGGGAGGAGAAATATAACTTTTCCCTCC
ATATTCCTAGGATCTCTGAATAGATTCTACAAGTAAATCTGAGAAAAGACAGACTAACAA
GAGAAAAACACAGAGAAGTTTATGAACGTGCGTTGTGCATACATACAGGGGTACTCAGCA
GCGAGTAACTCAAAACAGTGGTTAGAACTTGAGCTTATATGACATCCTCTAAAAACAAAG
AAAAATACATTTTTTTTAATGTTATTTATTTTGATAGAGAGCAGGGGAGGGGCAGAGAGA
GAAGCAGACAGAGAATCCCAAGCAGGTTCCGCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved