Felis_catus Locus Mono:91:SNORA52
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:91:SNORA52
Felis_catus
Mono:91:SNORA52
GeneScaffold_2439
SNORA52
1001..1134
2134
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCGCCCAACTTCAGCTCAG
GTCATGATCTCCCGATACATGGGTTCGAGCCCGCATCGGGCTCTGTGCTGACAGCTCAAG
CCTGGAGCCCGCTTTGGATTCTGTGTCTCCCTCTCTCTCTGCCACTAGCCCCCCCCCCCC
CCCCGCAACCCAGAGCAGGCTCATGCTCTGCCTCTGTCTCAAAAATAAGTAAAACATTAA
AAAAATTTTTTTTGAATGACAAAGTTCTTGTGCAGGCTTATTTACTTTGTGACTTGGCCA
CTTATTTCCTGAAATACATCTGTGAGGTTTACTTTTATGTGTCAGTTTGACTGCTTTAAG
GGATACCCAGATAACAGGTTAAAAAAAATTGGGGGGGCTATGTCTGGGAAGGTGTTTCTG
GAAGAGGTTAACATTCGATTGAAGAGACTGAGTGAAGAGATCTGCCTTCACCAATGCGGG
TAGGTATCAAACAACGTGTCAGGGGACCAAATGGAACAAGAAGGGGGAAGGAAGGGCTAA
TTCTCTCTTTTTGAGCAGGGACCTCCATCTTCTCCCATTCTTGCACTTCCGAGCTCCTGG
TTCCCAGGCCTTCAACTCCAGGACTTGCACCAACAGCCCCTTTGCTCTCAGGCCTTTGAC
CTTGGACTGGGAGTGACATCACCGACCCTTCAGACTTCGACTAAATTATACCATTGGCTT
TCCTGGTTGTCCAGCTGGTGGACAGCAGCTCCTGGGACTTCCTGGCCTCCGTAACCACAT
GAGCCAATCCCTATGATAAATCTTCTCTTACGTGTTTATCTGTGGGTTCTGTTTTGTCTG
TAGAATGCTGCTGGTACAACAGCCATTACTGAAACAGTTCAAAAGCAACTTCCACTATCA
ATTGCTTTTACCCGATATGAGACGTAAGAAGCTAGTCACTGCGGTCCACCCTAACCCCTG
CCAGTCAGCCTGTGGCCTGCCAGGTTTCGCTTGTGGACCAGAGTTCTTTAGAAGCCTCAC
CCAGAGGGGCGAGCAAGGCCTCAGTGGCTTTGTGCCAGGCTGCTTCTAGGCACTCCAGGA
AAAGAAAAAGCAGTAAGAAAAATAAGTTAGGAATTGAATGTATGAATGCTTTTTTACTGA
AGAAGTTAAGATATAAGTGCAAGGCTTACAGAAAAGTTGGAGAGATGTTCAGAATCAGAG
CCGGCTTTATTGAGAAATATCTAGCGATTATCGTTAACTATGTGTGAAGAAAGGGGCAAA
CCGTAGGCCCTGTGCCAATCTACTTGGGTCCCTGATCTAGTCCAATTATTAATTTCGGGA
ACACTTTTCAAGTCACTGGGCTGTGCCTCTGTTCGTCTCCTCAAAATTCTTTCTTTGGGC
ATTGCAGCCTGATTCGGAAAGAGGGTAACAAGGGCGGCCCTGAGGCACAGAGGTGGTGAC
CATGCGGTGTTCTGACTCTCGGCTTTATGTTAGATATGGTGGCTTCTGGGACACATGTGC
AGGATGTTCTGATAAGTTCTTCAGGGGAAAAAAAAAAAAGAATGACCCTCCCAACTAGTG
AAGGACCTTTTGGTTCAAAAGTATGGTGTAAGCTACTTTGGAATTTTAAAGGTGTTTTTT
CTCTTTTTCCTGTGGAAATGACTTAAAGGGTGGCTCATTTCTGAGGCTAGTCTGCAGAAG
TTTATTCAAACGTAACACACGACACAGGGATTCTCCGCAACCGACTGAGGTTTGTAATCA
TGTTTCCATTGGAATACATACAGGGGTTTCAACCTGAGATGGCAAAAACCTGTATCTTCT
TTGACTGATTGAAAGTCATTCATTCATTAATCTGTCAATCACTAAACCAATTTTTATTGA
GCATTGATTATGTTGCAGGTTCAGTGCCGAGTGCTGAGAATACAAGATGAGCAAGAAAGT
CTACTGGGAAGTGCGACGTCACAAACAAAAATTACAAAATCGTTTGAAAAGTGCTCTAAG
CCCTTTCTCCTGAGCTCCAGACTCAGTCTTTCGTTTCCTGTTGAGCATCTCCACGTGGTG
CCCAGGGACACCTCAGACTTCACATGCCCAGGACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved