Felis_catus Locus Mono:44:SNORA38
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:44:SNORA38
Felis_catus
Mono:44:SNORA38
scaffold_185996
SNORA38
1001..1131
2131
TGAATGTTCCAAATACTTGGGGTTCTGTAGCTTGGGAGTATGTAGAGCCCCAGTTGTTC
CATAAGGAATTACCTGGCACCAGCCCTCAGTCTGGCTGAGCAAGCTCGTAAAATTGTTAA
ACTCCCAGCATACCTTCATGCAAACCTCCCCAGATGGGAGTGAGGCCTCTGGGAAAGGAA
CCTGGGGCGCAGTTAGGGAGTTGGTGGTCTAATAAGTGGGGGATCTGAAGTTCTGTTACT
TGCAGAATGGAGCTTTATGCCTTTTTCTGCTTTTGTCTAAGGCTGGGACTTGTCATGTTT
TATTGTACATCTCTGGAATGATTTCTGTGGGGGGAGAAGAGATTATGAAGAGAGATAATG
AAGTAGCTGCTACCCTTTATAGCCTGGCACAAAAGGAAGAGTGTGTTTACTACTAGGAGG
ATACTAAATTTTTTATCTGGATTTGCTTGGCAAGAGGTGTCTGGGGGAAAGAGGCACCAT
GGCATTTGGGCTCTGTGGGAGTTTAAGGGACTGGGGACTTTGAATAGGCTGGAGGCAAAG
ACACCAGAGGGCCACATATCTGGGTCCCTAATGAGAACAAAAAGGACCATCTAGGTTTCT
TTTGGAGTTAGTAAAGGGAGCAGAGACTGAAGCACTTGGTGTCTGGCCCACAGGCTCCGG
CACGTTTTGGGGGAGGTGCCTGCAGGACCCAACGTACTCAATGAGCTTCCAGCGCAATGT
CCGATCGCTCGGGGCCGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACC
TGTTTGATACGTATAAGGGCAAGTCCTTAGAGATCCAGAAACCCGCTGGTGAGGGTCCTG
CGAAGATGTTCCTAATTCCTAGAGGCTGGGCATACATTTTAAAGCTCTTTGAAGGGAAAT
GGTTATAGTGCAAATATCAAAAGACTAGAGAAACACTAGAGACTTCCGAGTTTTATTTTA
GGTCCCATAGGGGACGTTGGTCTTTGGATGAACACCATTTACCCTCCTACAAAGGCGTGT
CTGTAGTTCCCTGTCTTTGGACACGTAAGAATCGGAGGAAGAGAAACGTGGATTTGGAGA
AGTCTGGGGCCAGCTTGCTTCCTGCAGGCTCAAGATCAACCATCCAACAGAGAAGCATCA
AGTGTAATGCATCTTAGTTTTTCCAGTGGAATTTCAGGGATTGCTGAAGGCAAAGAAAGG
AGTGGTTTCTAAAAGGAGTTTGGCTATAAGACATTAAGGGCATATAAATGGGACTTAGGA
GAGAAAGCTGTCAGATCACCCATGTGGGATGTTTTTTCACCCTCTCATCTTTTCTCCAGT
TGCCCCTCGCCATGGCCTGCAGAGTCTCGGGAAAGTTGCCATTGCCCGGCGTATGCCACC
CCCAGCCAACCTTCCAAGCCTGAAAGCCGAGAACAAAGGCAATGACCCCAACGTCTCACT
AGTGCCGAAAGACGGAACAGGATGGGCAAGCAAACAGGAGCAGTCCGACCCCAAGAGGTA
GACAGAGGCCTGGGGGATCTAGAGTGATGAGTATTTTAACTTTGAACTTCAGAATGAGTT
GGGGCTTGGTCTAGCCCAACCACATAAGATCCAGAGACAGGGAAGCCCCTTTCTTGGCTA
TTCTAGGACTCCTGTTAGAGGACTAAGGAATGACACTTTCAGCTTTCTGTCAGGTAGCAG
GAAGGCATCAACAGACAGCCTACACAGGGTAACTAGGTTATAGTATTTTGTCGTAAATAC
TTGTGAACGGTAACAAATGGGCCTGGGTTCACTTATCCTCCATGAATCGGAGAAGTAGGG
GAGGGCATCGCAGATTCTGGATAACTTTCCTGTCCTACCATCCCTTTAGTTCCGATGCCT
CAACCGCTCAGCCGCCGGAATCGCAGCCACTGCCGGCTTCACAGACGCCTGCCTCCAACC
AACAGAAACGACCCCCAGCAGCCCCCGAGGTATGTGAAGAACTGGATGTTACTGAAGGGC
TGGAGGCAAGAATGGTTTGTAGCTCCACCACCCACCATCACGATTTATTTTTCTGCTTCC
CCAGAACACTCCTTCGGTTCCAAGCGGGGTAAAGTCCTGGGCACAAGCCAGCGTCACCCA
TGGAGCACATGGAGATGGTGAGTGCAGGGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved