Felis_catus Locus Mono:101:SNORD83
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:101:SNORD83
Felis_catus
Mono:101:SNORD83
GeneScaffold_4236
SNORD83
1001..1078
2078
TAGCGGAGGAGTTAGAAGTGGCTTTAAAAATTTTTTTCACACAGGCATTTTCTAAAGGC
AACCCCGGAGCGCGCAGAACTATGGGATCGTGAAAGGGTCGCCTTCCGGTCCCTTGCGCC
TGCGCGCTGGCAGCCGAGAAGGCGGGAGGCCCTGGTAAGAGGGAAGCCGAGAACCGGAAG
TGAAGGCAGATTCCCTCCTTCGTCGCTGTTGCCGCCGCCATATGCGCTCGCCTTGCTCAG
GTAAGCTTTGGCCTTCTTTATCATCCGCTTCCATCTGCGTTTCTCTGCGGCCATTCTGCC
TCGTGGACTCCTGATACCCCTTCCACAGACTATGGTCTGGTCCCTGGGGCCTAGATGGGT
CGTTATTTGCATTGCTTGCATCCCTTTTGAGAGCTCTTAAGAGTTCGGGGGGGGGGGCAG
GGAAGGTAGGGGGCCCAATCCAAGATGGTGGCCCTAGCGCCATTGTGTTCCTTTTGCTCC
TTCGTTGGGCTCCTTCGTTGGGCTCCTCGTTTATCGGATGCCCCAGCGATGGTGAGAGGC
GGCGGTAGGTGCTCTTTGTTTCTGGGCATTTGCGGAGGGTGGGGCTCTTTTCACCTTCCT
TCTCATCTCTGGGTCCTCTTAATGGCCCAAGGTGGGAATAGGAGGAGGAGCCGCCTTACG
GGCCTGGTTGGACTTTTCTTACCTCGATTTACCAGCCTTTACTTGGAACATTTTCCAAAT
GTTTATGCGTGATGTCATTGTGTGTTTATAGGAAAGGAGTCTCACCTGAAGAGTAACGAA
GGGTGATGAGATCCCTTACTAGAGTTTGTAGTAGAGCTGGAGTGAGAGTTTATCTCGAGT
ACCTTTTTTCCTATTAATTGTAGCAGAGGGAAGATAGTATTCATCTCTGACCTAGTCATT
TCTCTTACTCTACTCTTCTATCCCCCCCCCCCCCACATTAATTACACAGGGATTTCTTAA
GCACCAGAAGGAGGTTACTGAGGAGTGGGACGCGGATGGCAGCCAAATGATGTTTATATT
TTGGGAAGTGAGCACTTTGCGCAATGATGACCTTAATCTATCACCCTTGACTGATGGCTG
CCTTGTTAGGGGTCAACACTTTGAGATGTAGGGAAAGCAAAAAGTCTTCCTTTGACGGTT
TTTCAGGACTTGTCTTTATCTTGTCTCCATTCTCCACTCTCTTGATTCATTTTGCTTTTC
ATTATCTATTTTCTTCACTGTTGTTACTTAACAGACCAGGAGTTCATATGCTGGTTCTCC
CCATCCTGCTTTCTGGTTTATGCTACTCTGATTCTAATCTCTTTGGGAACTTGTGTCTTA
ACCGCCTCACCTGGGACCACTATATTATGTTTGCTTTTATGTTTTGTGTTCTTGTTATTT
TTCTTTCCAGATAAAGGTGTCAGTACAGGGAAAGTGGGAAAAGTGTGGGGATGGAAAAGA
GGTGGTGAAGGCTCTGCTCACGACTAATAAGTCTTTTGTTTTTCTTGTTTGTTTTTTTCC
TAGCTCTTCTATCAGAAACTACGTTTTTTGTTTGTTTGTGTTTTTAAACTGTTGCTCAAG
CCCCCACTCTGCTCCCTTGTTTCACTTACTCTGCGTGAACCCTTCCGGAGACTCCTCCCC
TTCTCCCCCTGCCGGCCCAGGAATGGCAGAGAACGATGTGGACAATGAGCTCTTGGACTA
TGAAGAAGATGAGGTGGAGACAGCAGCAGGGGGAGACGGGGCTGAGGCCCCTGCCAAGAA
GGATGTCAAGGGCTCCTATGTCTCCATTCACAGCTCTGGCTTTCGTGACTTCCTACTGAA
GCCAGAGTTGCTCCGGGCCATTGTTGACTGTGGCTTTGAGCATCCGTCAGAAGGTAAATT
TTCTATTGGGCCTAGAGTATTCATTAGGTTCTTTAAGGGAACAAGAAACAGGTGTGTAAA
ACAGTTCCTCAGATAATACATATTTATTTAGGGTATATCAGGAAATAAAGTATCAAGAAC
TATTTTAGCAGTAGGAAAGATTTGTATAGATTGGTTTTTCATTCATGGTAACATGAAAAA
GCTAGTGACCTAAAAACAGCTGCTGCTGTTAGTTGTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved