Felis_catus Locus Poly:18:SNORD16
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:18:SNORD16
Felis_catus
Poly:18:SNORD16
GeneScaffold_3138
SNORD18, SNORD16
1001..1072, 1410..1508
2508
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCCTGGGTGTAGGTACAGAC
AGTAGCATCTGGAAAAGTGTGGGAGATGAAATCCAACAGATTCTGTAGGCTATCCTCAGA
AATTTAGTTTTGCTTTCAGGTGTAAGCCTTTGGAGAAGGTTGAGCAAAAAGAAACATGGC
CAGTATTTGTACTGGTAAGTTGTGTGATACCTGTTTGAGATGAAGGGGGCCAAGGGCAGA
AATTGGAAGGCGAACTGTAGGAGACAAGATATGCTGACATTTGGGGTTGAAGAGTTTATC
TAGATGGTAGTATTAAAGAGCATTTTCGAATCTCACAGTATCCCTTGAATCGTTTTTGCC
GTGTAAGGCCTGGTTTGAAAGCTTGATGATCAATTTTGTGCTTGAACTTGAGATTCTAAA
TGTTACAGTGTAAGAACGTTTTGAAGTTAATAAATGTAATATGTTGGTAATAGCCTCTGT
TTCAGCTCTGAGTGTTGTCTACCTCCCCAAATTCCAGTCTCCTGTAATTGAGGTTTTACT
GGTATTGTTGATGCGTGACCATAGTGCCTTTGGCTTTGTCAATATGAGTATCTTTTCCTT
TTTCCCAGGCGTGTGCTCGTCCATTGATATCCGTGTACTCCGAAAAGGGGGAGTCATCTG
GCAAAAATGTTACTCTGCCTGCTGTATTCAAGGCTCCCATTCGACCGGATATCGTGAACT
TTGTTCATACCAACTTGCGCAAAAACAATAGACAGCCATATGCTGTCAGTGAATTAGCAG
GTATGGATTTTTCGAGGATTGAGGTTTAAAGACCTGCTTAACAGCAGTGATGAAATAACA
CTCCATTGGTCCGTGTTTCTGAAGCACATGATTTTCCTGGATGTTCTGATGCTGTTGCTA
CCATGCATAATAGTCCTATATCAGTATGATTGGGTAGCTAAAACTTGTATTTCTTCCTAA
TTTCAGGTCATCAAACCAGTGCTGAGTCTTGGGGTACTGGCAGAGCCGTGGCTCGAATTC
CCAGAGTTCGAGGTGGTGGGACTCACCGTTCTGGCCAGGGTGCTTTTGGAAATGTATCCT
TTGTTCCACTATGTAGATGGGTCAGCTCTTCGGGAATTTATCGAATTGAACCTGGCTTGT
ACATAGTTGAAAATATTTCAAACATACTAATAGTGTCCAGGTTAAATATTGCTCTAGGCA
GACAGGGGCTTGGCATTAGGAAATTTTGCTTGCAATGATGTCGTAATTTGCGTCTTACTC
TGTTCTCGGCGACAGTTGCCTGCTGTCAGTAAGCTGGTTCAGAAGGGTGACGAAAATTCT
TACTGAGCAAGACATGATCTTTTTTTTTTAATTGCCAAAATTTTGAGAAATGAGATTCTT
AACTGGGGAAATAGATGTGTCGTGGGGGCCGCATGTTCGCACCAACGTTACTTGGCGCCG
TTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved