Felis_catus Locus Mono:23:SNORA62
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:23:SNORA62
Felis_catus
Mono:23:SNORA62
scaffold_156022
SNORA62
1001..1150
2150
CCTGTTTCTGTGAACTGGACCAAGTCTCTGCCCTGCCCTATGCACAAATGTGAGAGCAG
AATCTAACGAAAAGTTTAAGTGCCACTATTACGACAATCTTCTCCAAAGTAAGCCTGCAG
AAATAGCCTGGGTCCCCCAAATGGTTGATAAATCAGTAGAAGGAATCCGACCAAGTGTTT
TCTCCCTAGCGAGTCAGATTTATTAGACAAACATTTGTCAAGTGCCGCCAAGGCAGAGAA
CGCCCTGCCTTCCTGGAGACGACATTGGATTGAAGGGGCAGACGACAAGCAGGCAGGCAG
AAAAATAACACGATTCTAAATATCACAGGTGGCAAGAGTAAAAATGTAGAAAAAAGAGGA
TTGGAGCAACAGAGTACGTGAGGGGTTTTACAGGATTGGCCAGGAAACCTTTGAGGAAAT
ATCATCTCATGGAGTCCTCACGGAACCAGAACGAGGAGCCCCGCGCTGTGGAAGCGAAGA
ACGAGCCAGCCTCCGCATGGGGAGCCTGGCAACTGCGGCGGCCTTGAAGCAAGACGGGAC
CATAAATGATAGAAAATTAAGTAATGCCCAGTATGCAATGGGTCCAGCTCAAGACATAAG
ACAGCAATTCAATCCAAATTTAAACCAAGAGGGTGAAAATATCAGTGTTCATGACAGCTT
TATTGGCGACACATGATTACCAAGCAAGTCCTTTACCGAGGGGCTGTGCTAATAAAGAAA
ATTGCAAATCAATGGTTTCTGTACCCAACTTTTTTCCCTTTAGCTCACAGGGATTTGAAG
CGTTGAACAGCAAAGATTAAAAGGAGATTATGACTCGTCCCTCTGTCAAAAGACCCATTC
AACACCGACCAAACAAGAACAACAAACTGCAAATTCACCCAAACAACAACCAAAGGAAAA
CAGCCATGACTAGTGTTGACTTTGTCACTTTAAAACTCACACATACGATCTTCTTTTGCC
AAAATTAATGCAAATCAAGACGACAACAGTGAAAAGAAAGCTTTTCAAACCAAACAACTT
AGTACACGTATGGCTTGCCTGTGAGCTCACGAGTGTGGGTAGTGTGGCTACATGAGGGGT
GGGTCTGCGGCTAAGACCATACGAGTCTCTGGTCCAATGAATGGAGTTTGATAGTAACTC
TTGCTAAAATTAAAAAAAAAAAAACAAAAAATAAAAATAAAAATTCAGTTATGACACCGA
ATGCATGATCCATAAAGAGAAAAACTAGTAATTGGACATAATTTTTTTATTAATGTTTTA
TTTTTTTATTTTCTTGAGAGACAGAGAGAGACAGAGCATGAGCAGGGGAGGGGCAGAGAG
AGAGGGAGACACAGAATCCGAAGCAGGCTCCAGGCTCTGAGCTGTCAGCACAGAGCCTGA
CGCGGGGCTCAAACCCACTAACTGTGAGATCATGACCTGAGCCGAAGTCAGACGCTCAAC
TGACTGAGCCACCCAGGTGCCCTGCACATAATTAAAATTAAAAACTTCTGCTCTGCAAAA
GGCACATAAAAGAATCAAAAGTCAAGCCACAGACAGGGAGAAAATATTTGCAAAACACGT
ATCTGGTAGAAATACTGGTTCCCCAGATATTCAAAGAACTTCTAAAACTCAAAAGTAAAA
CAAACGACCCGATTAAAAAGTGGGCAAAGGATGTGGACAGACTCCTCAGGGGAGATGACA
TACAGGTGGCAAATAAACACGTAAGAAGATGCCCCACGGCACCTGCCACGAAGGAAATGC
AAATTAAAAGCACAGTGCGATGCCACCGCACACCTGTCACAGTGGCAGAAAAATCCGGAA
CCCTGACAACATCAAATGCTGGCGAGGACGTGGAGCTGGTGGGAATGCGAAATGGCGCAG
CTATGTCGGAAGACAGTTTGGCATCTTCCGAAACTAAGCTACATACGGTATGATCCAGCA
ACCGTAGTCCATCGTTTTCACCCAAATGAGTTGCGTTAAAAACGTAGGTCCACGCGAAAC
CTGCACGTGGATATTTATAGCAGCTGTATTCATGTCCACAACTTGGAGGGAACGAAGAAG
TCCTTCAGTGGGTGAATGGATAAACAAACTGTGGTCCATCCAGACAATGGAATATTATTC
AGCACTAAAAAGCAATGAGCTATCAAGCCATGAAAAGACATGGATGAAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved