Felis_catus Locus Poly:3:SNORD113
snOPY snoRNA Orthological Gene Database
Felis_catus Poly:3:SNORD113
Felis_catus
Poly:3:SNORD113
scaffold_147192
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1073, 3457..3531, 5219..5292, 6407..6481, 7195..7266, 8619..8693
9693
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGCATATAGCACATTCGTATTCTGATGCAGAGTGCTATTGGGTAGCTCC
TTGGTGAAGGAGTACACAGAAAGATGGCAGACGGTTGGAATAAGACGCAAGGATGTTAGT
TGATCCATACATACCTCACTGAGGGCCACTACTGAGGATATTTTTAGTTTATGGGAAAAG
AGTCTGTAAATAGACCTTGGTCATATCCAAGGATCTTGTTCTTGTTTTTTTTTTTTTTTT
TTTTTTTAAAGTCATGGACATTGATTTTATTACTGTTGATGAATCAGCGTTGATGGATCA
ATGAATGGATCCATAAACAAAGGTATAAATGAAGAAAAAAATGGATCAATGATGAGTACC
CTGGGGTGTCTGAAATCAAGGATTTTGATTAAACCCTATAACTCTGAGGTCCATTACAAG
AAGATTCCTCTCTTTGGTCTCCATGGGAAATGAGTTTATTCTGGGAGCTAAAAATACTCA
GGAGTTTGCTCTTGGGCTTTTAAGTATTGTGTTTTCAGTAAATCAATGCATGAATAAATC
AAGAAACAAATAAATGAATAAAGACAAAATGGGTTATTTCTGGTCCAAATAGGAGAGTAT
GTAATGTAATATATATAATATAAAAATCAATGTTAATACATTTCTGAAGCACTGCATTCC
AGTAAAATAAATGGATTAAAGCTGACCCTTTTGGGTAAAGAGAATTTAGATAAATGGATG
TAAGAACCCATGTTGTTTTGCTGGGTTGGGTTGTTGTTTTTCGTTTTACTAAGAGAAGAG
CAAAACATGTACTTAAAATTAATTATCAATTAAATACGTAACTGAAAGAGGGCTTACACA
TGGACTTTTGTTGAGAATGTGTCACATGGCCAGCTACAATTAATCCAACGATCTTCGCTA
TGTTTTTAATTAAAAAAAAAAACAGGAAAAAATCATCTGATCTTTTTTCTGTGCCTAAGG
AGCATATGGACAGGCATTAATATTGTCTTGTTTCTGTGGATTCACAAATATTAATGATAT
TATTAAAAATGAATAAAAGAACAAGTAAATATATTAATCAATTATTTGAAAGAAGACAAA
GCATGGACCATGAGGAGCATGTGTTCTGGAACAAGGAGAGTGATTAATCCAGTTCTACCA
AACTGCTCTCCAGATAAAGAAAATAAGACTTATGCTCTTAGATTTTGGGAATGGTGAATA
TGCTTAGATTGACTTTCTTTTTGTGGCTTGGTGCAATTTCTTTAAAACAGCACAAGATAA
GTGACTCCATATGTGACTATGTTAATACATACCTATAGAAAGGTGGGACAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATAGAAACATGTAAGTAACAGTCAAG
GTAATTGCTTTTGGCTTGGTGGTTTGTCATGGGTGTTAACTCCGTTATTGAAAGGGAATA
AATGGCTACATATACTAATAAAATGAATGAAGGTCATGTGTGGGCCAGTTCAGCACATCT
GTGGTCAATTAAGGAGAAGAAAGCAAAACGATTTTATTCATTTTCACAGTTAATTATTCA
ATTAATGAATGGAAAACGTATTATTCAATTTGAATTTTGAGTCACAGTTGATTTAAAACC
CCCTTTATTTACAGAGGCGTAGTTTGGTCACAGTGAAATAGTAAAATGGGGTTAATATGA
AGTATCATATTAATCTATACAGGAAACATTGTGGACAACTAGTGAAAGATATATATCAGG
GAGGTCGGGGGGATGTAATTCTATACAGAAATGTTAGAGATATCCAAGGATCTTGTCTCA
AGTTTACATGACCTTTAGGCATTTTATTATTATTAGGGAATTGATGAATTAATCACTTAG
ACATGTACCTATGACTGAACATAGTGAAGGCCAATCCTGGACCAATGATGATGATTGGTG
GAGTATGAGTCCTGGATGATGGATACTATGTAACTGGAACTCTGAGGTCCAGCACGATAC
GAAATCTGGTCTATACCTTCTATTGGAAAGGATCCAATGGACAGATGTTAAGAATATTTA
AGGTTCTTGTTCTTAGTTTGTGTGTTCCTGGAAATTGATTCCATAATTGTGAAGGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNATTTTGTTAAGGGGAGAATGTGTAAATATTATGAA
AAAATAATAATCAAATGAATGAGTGAATGAAGTGTGAAAGCAAGGCTGAATGGAGAGACT
GTCTCAATTTTTAAAATCATTTCTCCTGCTTTGTACTCCTCAGAATGGATGCAGTTAAGC
TGATTCTCTGTGGTTGCCTCCATTGTCAGGAACACAGACACTAATGTGAGTAATGGTTAC
AGGGGTTTTAGTTTGAATGGTTGCTTTTTAAAAAGTGCCTTAATAAGATGTATTTTGTAC
GAGCAGAGAAAGCCAACTGAGGCCCAATGATATTGGGTATATATATGCTATTATATGAGA
CATTGTGTTGATAAACCATGTATGACACATTGAAGATAATTAATATAAGAAATATACTGA
TGTGGTAAGTGATTGTATAGGCGGATGGAAGGACATTTGATTGTATAGGGCGGATGGAAG
GGACATTTAGTTCTTTTTATTTATTTTTTTAATTCATAGGTATCTGTTTTATTATCACCA
GGGAATTGGTAAATTAGTTAATAAATATTGATGGCAATGAAGAAAAAGAGGCCCAAGCTT
GGATCGATGATGAGGCTGGTGCCGTATGAATCACGCATGATGAATGATACGTGTCTGGAA
CTCTGAGGTCCAACACATAGGGAAATCTAGTCTACTGCCTCTTTTGGAAATGATCTTATA
GGCAGATGTTGAGAATATACAAGGATCATGTTCTTGACCTCTGTGCACACGGATTCTGGT
TCTGTTATTATTATTGGCTATATTAAAATTATAAGTAGCCAATAAACAAATAGAAATAAA
TATGAATAAGTAAAACATTGGCGAATTATGAAAATGTGTCATGAAGTAAGAGAATCTATT
AATATATGTTGAAAACACTGAGCTGCTTAAGAAGACATGGTTCAAAGGTGTTACTTCTTT
GGCTAATGATGATACAGGAAGTACAAGTAACCATCATTGTTCCTGTTCTGGCTCAGTGGC
AAATTTGACGTTCGCCTTTTTTTTTTTTTAATGTTTATTTATTTTTGAGAGACAGAGTGT
GAGTGGGGGAGGGGCAGAGAGACAGGGAGACACAGAATCCGAAGCAGGATCCAGGCTCTG
AGCCGTCAGAGCCCACGCGGAGCTTGAACTCACGAGTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGGTTAAATGCAAGGATTGCATAGAGAGGTGGAGAGATTGTGT
CTCAGTTGTTTTTTTTTTTTTTTTTTTGGTTTGTTTTTCTGTTCTGTCTGCTTCGTACTT
CTCAGAGTGGGCACACCAAGGTGATGAAAGCCATCTGCCATGGTTACAGGCTCTATATGT
AGGAGATGGAGACCAGTGTGAGTACAAAGTTCTCATCTTATTTTTGCTGATTTGTTTAGC
ATGTTGACTGTAATATTAAAAATATTTAAATATATAAAAAAAAGCCAGCCCCATGATAAA
TATGAAATTGACATGAGACATTATATTGATTAACCAGTGTTTGCAACATGGTAGATGATT
GATAAAATATATATTCAAGGAGGTGGCAGTGATTCTATGGACAGATGTTAGGGATACTTG
GGGGTCTTATTTTCAAGTGTTTTTGATTCATAGATATTTTATAGTTATGGATTTATTGAT
AATCACTGATAAATGTAGAAGTGAGTGAAGAAAAAGAGGGCCAGTTCTGGACCAATGATG
ACCACTGGTGGCGTAGGAGTCATGGATGATGAATACTACGTGTCGGGAACTCTGAGGTCC
AACAAAATAAGAAATCTAGTCTCTCTTCTCTGTTGCAAGTGACCATATTGACAGGTGTTA
GTAACAGACAAGGATCATGTTCTTGTTCCTTGTATTCATGGATTTTAATTCTTTTAGTAT
AGAGAAGTGAAAGAATCAATAATCAAATTCAAATAAACATGAATAAGGAAAGGATTATAA
AATATGTAAGTTAAGAAATACCTAAGTGGTTGAGTAAATGAAACGTGGAATGCAAAGCCA
AAGAAAATAAGGTCTAAGGGTTTTTTTTTTTTTTTTTTAATATCACCTTCTGTGTTTTGC
ACTTCTCAGAGTGGATGCCCTGGAGCTAATTTAAGGATTCTTCCATGGTCAAAAGGCGTC
TGCTTGTCTCTGTGTGTTTGGTGTATAGAAATGTGAGTTTTTATGGGTATATACTTTGTA
TTTGAAAGTTATGAAATATAATAAAAGAAAGCCACCCATGGTCCATTGATAAATATGGAA
TTGATACTGCATTGCATTATATTGATTAATCCCCATATGAAACTTTGAGGGTGATTAATC
AAGAACATATATTGATATAGTAAATGATTGTATGGACAGATATAGGACTATTCAAGGCCT
GTAGTCTAGGGTTTTTTTTTCTTTTTTTTACTTATAGGTATTTATTTTATTATTTATTAC
TTGATGAATTAATTAATAAACAAAGGTAGATAAAAATGGAAAAAAAGGCCAAGGGTGGAC
CAATGATGATGGCTGGTGGCGTATGACTCGTGGTTGATGATTACGTGTCTGGAACTCTGA
GGTCCAGCGTAAAAAGAAATCTAGTTGATTATCTCTGTTGGAAATGATCCTATAGACAAT
TTTAGGATTTCACCAAGATCTTGTTTGGGGGTCCTTATGTTCATGAATTTTGATTCTATT
GTAGTAAGTGAATCAACAAAAAGATCAATATAGAAATATATATAAAAGAAGATGACGGGT
GAAGCATTGTACAATTATGAAAAATGTAAGGCAAGAATAAGAGAGAAATAGTTCAAGGGT
GTTACCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTATTAAATGTAAACTGAAGAAA
CTGATAGAGGTTAAGAGATAAACGGATCAAGGGTGTTACCCCTTTTTCTAAGGATCATAA
CATTACATTTATATTTATGTTTGTTATATGTGTATAAATTAGGAAAAGTAATAAATACCT
TTATGAATGAGTAAATGAAATGAGGAAAACAGGACCGTTTAGAGAAGTCCTCAATTTCTT
TTATCATCGTCTCTGCTCTGTACTCCTCAGAATAGGTACATGCGTGAAGTTGGGTTGAAG
CATCTTTCATGGTCACGAGCTCTGTGGTTGCCTTGTCTAATGAGCATAGAGGCCGACGTG
AGTAAGAGTTAAAGTTCATGTCTTTGAGAATTTATTTTCAGGTACTCACTGTATTATTAA
AAGTGTGAAATATAATAAGAAATGCCAGCCATCATGAATGATAAATGTGGGGTTTATCTG
CTGCGTGATAAGTATTAGTCCACATATGGAACTTTGATGATCATTCACGAAATAGATGTA
TCAATGTGGCAGATGATCCTACAGGCAGATATAGAATATTCATTGCTCTTATCCTTGGGC
GTTTGTGAATCACGGCGTTTTAAGAGTTAATATTAGTGAATTCATGAATTGGGCAGTTAC
CTTATGCAGATGAGAATGAGGAGGAAGGAGGCCCAGATCTGGACCAATGATGATAGTTGG
TGGCGTATGAGTCATGGATGATGAATATTACGTGTCTGAAACTCTGAGGTCCAATAAAAA
GAAAGATCATCTCTTGCCTCTTTTTGCCATGATATCATAGACAAATATTAGGAAAAGAAA
AGAATAATTTTCTTGTTTTGTGTTTATGAGTTTTGATTTTGCTGTACAAAATAGCCCAAA
GAGGTGATCAGTATACAAGTCTAAATAAGTTGAAATGAAGAGAGTGAAGCAAGCTTGCTC
TTAATATACATGGTGAGGCGATAAAAACCATTAACATATACAGAAAACGCTGCAGTTCAT
TGAGAAAACGTAAGTGGTTCACATGTCTTACTCTTTGGCTAAGAATGATACAGAGACCAC
GAAGAACAGCCAAAGTTCCTATTCTGTGTTAGTGTTAGACTTGATATTGTTCATTTTTTA
AGAGAAAAATAATAAATACGGTCCCAATTCACTGTATTCCTAAAGGGCTCACTGAATGTA
GATAGGATGTGTGGGTCGATAGAGAGTATCTCAGTCTCGTCGCTTTCTGTTCTGCTTTGT
ATTATTCCTCAGCATGGATGCACTTGAACTCACCTAGGTGTTTGGCCGTGATCGGATGCT
CCATGGATGCCCCTTGCGTGTAAGAGGATGGAGACCAATGTGAGTCACAGTCAGATTCTC
CTCCTAGTTTAGGTGGTTTGTACAGGATATTCAGTGTCATATTAAAAATTTGAGGAAGTC
CAAACACAGCTCAATGGCAAATATGGCATTGTCACGAAACACGTTAACTAATCAATATTG
TCCACAATGAGGATCATTAGTGAAATAACTATAAAGATTCAATAGGCAGATGCTAGGGAT
ACTTAAGGATCTTGTCCTTGAGTTTTGTGATTCCCAGATNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved