Felis_catus Locus Mono:109:SNORD18
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:109:SNORD18
Felis_catus
Mono:109:SNORD18
GeneScaffold_1365
SNORD18
1001..1071
2071
AACCTCGATACACATCACTGCAGAAAAGATTGGCACAGAGGAGGAGAGGTGTTAAATGG
AAAGGGAGGGGCAGCTCTGAGAGAAAAGATGATGCAATGCCATGAAGACCCATAGATCCC
ACACAGCAGGGCCAACGCGGAGCAAAACCAGCAAAAAACAAACAAAACAGAACAAAACAA
AACAAAACAAAACCCCAGCCATTTAAAACACATCTAAAAGCCATATGATGTATTTCCAAC
TTCTTTAACAGAGAAAGCAATCTGCCTTTCAACTAAGTGTCCCAGTTACAATTCTGGGGA
AATTGAATCTCACAGGAAGTTGCTCAAGATCAAATAAGTTATTGAAAAAAATTATGAAAA
GACACTAAAACTCTTGAATTCCATCTGGCCCCTTGCTCTCGCCAAAACACTTAGCTTGTG
ATTTTGTTTGCAGCCCATCGAGAACCCAAAAACACTTCGAAAGCATGACAAGAACGTAGA
AAAGCGCCCCCCCCCTTGCGTGTGAAGAAACCTCCTCTCCCTGGCACCAAAGTTGTCGAC
TTTTTCCTCATATTTCCCGTCATAAATTCTGTCACCGTGTTTTACAGATGCCCTACTTAT
GAGGCTAAATGTTGAACTGTTCACTTAAGGTCTTCTGACTGAAAAAATGGGTGTGAATGT
CTCCCTTCTGACCCGCTGGGTTTGGACATAGCTCCCCTGTGAGGTAACATTGGACACCAT
GTCTGCTGGGCTTCTACAGCTGCCTAAGGGCGTGGGGCCCAGTAAAGGCCCATGGGGGGG
TTAGGGGAAGGAGGAGACTGCCACTCAAAGCACATTGGGATGCTCGCAGCTGCGTGCGTG
GTGTGAGTGGAAAGTGGAAACATTCGACAGGAAAGCATAGACATAGCATAGACTTGAAAG
ATGACTCCACAGAAAAACAGCAGGAACCCGAGGGTTACGTTAGGGTCAAAACTCCACACC
AACCAGTCAGAATATCAATCCGTGAGGACTATCGAGAAAGAACATGTTGATAAAATCATC
ATTATGTTCCGTGTTTCTGAAACTTATACAAAGAAAGAAAAGCCCTTACGATGGCTTCTT
CTCTCTGCCCACCCGGAAGTTGTTTTTTTTTTTTATTCTTTAAGTTTTTTTTTTTATGTT
TATTTATTTATTTATTTTCCTTTTTTTTTTAAATATATGAAATTTATTGTCAAACTGGTT
TCCATACAACACCCAGTGCTCATCCCAAAAGGTGCCCTCCTCAATACCCATCACCCACCT
TCCCCTCCCTCCACCCCCCATCAACCCTCAGTTTGTTCTCAGTTTTTAAGAGTCTCTTAT
GCTTTGCCAGCCCAGAAGTTTTGTGTAACGTTTTACTTTCTGTAGTTGGTATTATGAGTA
TTTTCATAGGCATCTGGGGGGAAAAATCCAGCTACAAATGCCACCTCCCCATTCCAGCAT
ATTCTTCTCTGCTGGGATTCTGTCTCATGCATTTGGAGGAGAAAACAGCGGCCATTTCTA
AGAATGTGGTGTTGCCCACTTAGCGGAGGTGTGGAATGAGGGCAAGTAGGAAGTGTAGAG
GATGGTATAGTGTTACAGGGAAGCATCACACAATGAGTGCCTGCACTACAGAGAATGTTT
TCATCTTGGTCTCCAGGTTCAAGTTATTCTTCCCAACAAAAGAAGAAAAATTAAGAACAT
GGTTCCCATCACTACCAAGTAAGTTAAGTTCACGATGCCTTTGAGTAAGAGACACAGATA
AGCAGAGAAGAGCTGCAATACGATCAATACCATCACATCAGGGACGACACCATCTCTGGG
GTGATAAATAACAGCAGTGAATGCTTTTGCAGAATGGTGGATGGAGAGCAAACCACTTGG
AAAGCAATGGTAAAATTCTGTATTGACGGTGAACTTCGGCTTCGTGGGGGGGGGGGTTGG
TTTTGGCAAAAGTATAGACTGCAGCTTCTGAATATCTTTCAAAATCTTCAAAGTACTTAT
TTTTATATCTATATATGTACACCAGTCAGTTGTGATACAGAATGACCTAAGCAGAGTCTG
AAGCAGGACCCTTCAGACCAGAATCAGGGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved