Felis_catus Locus Mono:117:SNORA67
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:117:SNORA67
Felis_catus
Mono:117:SNORA67
GeneScaffold_2284
SNORA67
1001..1113
2113
AAAAAAAAAGCAAAGGAAGATAACAGCATAAAGTAGATGTTACAAAAATCAAATGTAAG
GATGTCTTTTAAAAAAATAATTTATTTTTTAAAGTTTGTTTGTTTATTTAAGTTATCTCT
ATACCCAGTGTGGGGCTTGAACTCACGGCCCCAAAATCAAAGTTGCCTGCTTAGGCGCCT
AGGTGGCTCAAGGTGGTTAAGCGTCCGACTTCGCGGCTCAGGTCATGATCTCACAGTTTG
TGAGTTTGATCCCTGCATTGGGCTCTGTGCTGACCGCTCAGAGCTTGGAGCCTGCTTCTG
ATTCTGTGTCTCCCTCTCTCGCTGCCCCTCCTCTGCTCACACTGTCTCTCTCAAAAATAA
ATAAACATAAAAAAAAAAATTAAAGAGTTGCATACTTCCACTGAGCCAGTCAGGCACCAC
GTGATGTCTTTTTTTTTTTTTTTTAAATCAGGAGACTTCACTTCACTGAAAATGACTCCC
TGAGAAGATGAGACAATCAGACAGCTCATTCCTATTTTATTATTATCTTCTTAAGTTTAT
TTATTTATTTATTTATTTTTTAAGTTTTACTTATCTATTTAGAGAGAGAAAGCACAGGCA
GGGAGGAGCAGAGAGGGGAGACAGAATCCTAAGCAGGCTCAGCGCCAACAGCACAGAACC
CAACGTGGGGCTTGAACTCACGAACTGAGAAATCATGACCTGAGCTGAGATCAAGAGTCG
GACGCTTAACTGACTGCACCACCCAGGTGTTTCTTAAGTTTATCTCTTTAGAGAGAGAGC
ATGAGTGGGGTAGGGGCAGAGAGAGAGGGAGGGAGAATTCCAAGTAGGCCGCAGGCTGTC
AGCACAGAGACTGATGTGGGGCTTGAACTCATGAACTGTGAGATCACGGCCTGAGCCAAG
ATCAAGAGTCAGATATTTAACCCACTGAACCACCCAGGTGCCCCTACTTACTCCTATTTT
AAATAGGGATCTGCTTTCTTTAAAAAAAAAAAAAACACCATCTTCATGCCCCTCTTCAGG
AAAGTAGCAACTTGGAATAAAATCTGGCACACCTTAGGTTGCTGGGTAAGAGGGGATGTT
TGTTTCCTTTGCCTTCCCGTGGCTGCCTAGCACATACATTTCAGTCTCTTCTGAATAGAC
TGTGTGCTCTTCTCATTGCCATGCTGAAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAAGAGTGTGGCTGTCAACATGGTGGCAAAAGACAAGAGGACTCTTCGAG
ACACTGAGACCTTCTACAACACCTCCATCGAGGAGATGCTCCTCAGTGTTGCTGACCTTA
TCTGAGGGGCTGTCCTGCGACCTAACCCTACCCGAGGTTCAGTCCTTAGGGGGCTGAAGA
GCAGCAGGAAAGGGGAGGGAAGGGAGCCTAAGGATGGACTTCTCATTTTTCCCCCTTTGA
CTAAATGTCACTTTTTGAGGCAAAAAAAAAAAAAAAAACAGAAACAAAAACAAAAATCCA
CCACCTTCATATCCCACACCATGATTATGAAATATATCCTCTTTGAAAGCTCAGAAAATA
TTAAAGTGATTTAAAACAAAAAACAAAAAACAAAAAACCACCTGTCATCTTACCACTCAG
ATTTAACCTATTACCATTTTGGTGTTTTTTCAATGCATACTGTTCTATGTGCTTCAGTAA
TGTGCTTTTGCAAATATTCAAGCTGGGTAACAACTCCAAAGAGGAGAAGGGATCTATGTA
GCTTCTCCCTACAAATCTGATGTGTAACATTTCCAAGTTTGTTTCGGTAAAAATTCTATG
CTCATCCACAATTCATCTGTATTTATTCTGGCTTTGTGAAGCATCTTGAATTTACATCTG
AAAATCGTATTCAAGCTCATTTATATGTCACACGGTTCCTTTATGACGCGGTTCCTGCTG
CTCTCCCTAACCTCGACGTCTATCACACCCACCCTCACTTTACACTCCAGCAAACCTGAA
CTTGCTATTGTGTTCCAAACACACCTTGCCTTTAGGGACCTGTGTTTTGGCACATGCTGC
CCCCCCCCCCCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved