Felis_catus Locus Mono:51:SNORD87
snOPY snoRNA Orthological Gene Database
Felis_catus Mono:51:SNORD87
Felis_catus
Mono:51:SNORD87
scaffold_196599
SNORD87
1001..1089
2089
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTCAAGCTCTGA
GACAGAAAAAGCAATGGCTAGGTACTCATTAGGACCATCATGTCCTAACATCGATACTGC
CACAGTAAAGAACATCCTATATATAGCCACAATTTTTCCTATCCATGCTAATAAACCCAT
TTCCAGCTTGGAAAGATCATTTATAGAATTATTAGGGCCTAAACAGTCAAAAGTACTAAT
CTGTTCAAGCCATTACAGAGGTTCTAAATTTGGGGGTTATCCGTTTGGACTACCAAAAAA
AGTAGAACTAAGCAGAAAGTACTTCATTCCATGAGAGATGTGTTAAATAACAAAATTATT
CCAGTATATGGCCTCAAATGTTAGTAGTTTTTATAAAAAGTTAGATGGGAGTCAGGAAGG
TTGTAAGTAAAATGTTTATGGCTCCTGATGAGAATGAAAAAGTCTTACTGGACCATTCCT
GCATATAAGATGCCAAACAGATGGCAAGTACAAATGAGAATTCACAATGAAATATTTTGA
TTTCTAGGTACAACAGAGCCTATGAGTTGAAGATGAACGTTGTGATGTTTTCCAAAAACA
TCTGAGGATGGCTGTGATAAAACTACTAGGAGCACAACTGCATGTAATGAGGTACCAAAA
CTTAATGTTAAACACTGTGCTTTGTTATGTATTTATGGTACTGTCCAAGAAAAGCAGTAC
CAAAAACATTTAGTAGGTTTTTGACCTAGATAGGTTTAGTAACTGGCACAATGATGACTT
AAATTACTTTTTGCCGTTTACCCAGCTGAGGGTTTCTTTGAAGAAATAATTTGAAGACTG
AGATGCCAGTTACGTATATTGTTTATGTGAATTACTCAAGTATAATGCAGTTTTTCATTA
AAATGGGTTATATGTTCTTTTCAGCATGTAGGTAGCTGCAGATGAATGTCCAAGTCCATA
ACTGTTGTGGTTAAAAATTCTTCATTGCCTCGGTAAGTAATTCTGGCAATCACAGCTAAT
AATAATTCAAAAGTATCTGAAACTCCAAAGGGTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
TGAAGATGATAGACTTGAAAGGGAAAGGGGAATTGTAAATTCCAAAAATCCCTTTACTAT
TAAGAACAAAGTTTAAAGCAGTAAACATTAAATTATGCATAGGAAGCGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved